ID: 1174297653

View in Genome Browser
Species Human (GRCh38)
Location 20:49560628-49560650
Sequence CCACGTGAGCAAAGACCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174297650_1174297653 -8 Left 1174297650 20:49560613-49560635 CCTCCTCAGGAGATGCCACGTGA 0: 1
1: 0
2: 1
3: 9
4: 106
Right 1174297653 20:49560628-49560650 CCACGTGAGCAAAGACCAGAAGG 0: 1
1: 1
2: 0
3: 8
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174297653 Original CRISPR CCACGTGAGCAAAGACCAGA AGG Intronic
900651373 1:3731626-3731648 CCACGAGAGCAAGGAAGAGAAGG - Intronic
900776961 1:4592795-4592817 TCACTGGAGCAGAGACCAGAGGG - Intergenic
901615754 1:10538275-10538297 GCACATGAGCAAAGACTGGAAGG + Intronic
903077234 1:20780759-20780781 CCACATGAACAAAGACAACAAGG + Intronic
903626666 1:24735598-24735620 ACATTTGAGTAAAGACCAGAAGG - Intergenic
903682064 1:25103703-25103725 CCCCGTGAGCAGAGAGCAGCTGG - Intergenic
904346758 1:29877514-29877536 CCACGAGAGCTGAGACAAGAAGG + Intergenic
904805123 1:33125820-33125842 ACATTTGAGCAAAGACCTGAAGG - Intergenic
906003428 1:42446877-42446899 TCAAGTGAGCAAAGAACAAATGG + Intronic
906209925 1:44007084-44007106 GCAGGTGAGCAGAGGCCAGAAGG - Intronic
906451756 1:45955600-45955622 GTACTTGAGCAAAGACCTGAAGG + Intronic
906496085 1:46304912-46304934 CCAAGTGACCAGAGAACAGACGG - Intronic
906551512 1:46669718-46669740 ACACTTGAGCAGAGACCTGAAGG + Intronic
907391487 1:54161183-54161205 CAACCTGAGCAATGACTAGAGGG + Intronic
907905889 1:58783617-58783639 CCACGGCGGTAAAGACCAGAAGG - Exonic
909012449 1:70350217-70350239 CCTTGTGAGCAAAGACAACAGGG - Intronic
909461902 1:75926387-75926409 ACATTTGAACAAAGACCAGAAGG + Intronic
911116567 1:94251740-94251762 CCATTTGAGGAGAGACCAGAAGG - Intronic
913322771 1:117600775-117600797 TCAAATCAGCAAAGACCAGATGG - Intergenic
915990582 1:160512016-160512038 CCTCGTGAGCCAACACCACAAGG + Intronic
918096057 1:181335094-181335116 ACATTTGAGCAAAGACCTGAAGG - Intergenic
920206952 1:204299204-204299226 CCATGTGTGCAAAGTCTAGATGG - Intronic
921253822 1:213321826-213321848 CCATTTGAGCAAAGACATGAAGG + Intergenic
922185835 1:223273549-223273571 CCATGTTAGCATGGACCAGATGG - Intronic
924088675 1:240480550-240480572 ACACGTTAGCAAACATCAGAAGG + Intergenic
1062820361 10:530187-530209 GCACGTGAGCACAGATCAAAGGG + Intronic
1063381078 10:5586546-5586568 CCTCGTGGACAAAGAACAGATGG + Intergenic
1070191735 10:74117688-74117710 ACAAGTGAGCAAAGATCTGAAGG + Intronic
1070310066 10:75266496-75266518 CAGCATGAGCAAAGACCTGAAGG - Intergenic
1075153424 10:119955355-119955377 ACATTTGAGCAGAGACCAGAGGG + Intergenic
1075674036 10:124283466-124283488 CCATCTGCGCAAAGACGAGATGG - Intergenic
1078069609 11:8099778-8099800 GCTCTTGAGTAAAGACCAGAAGG + Intronic
1081717957 11:45264471-45264493 CCCCATGTGCAAAGACCCGAGGG + Intronic
1082675683 11:56099144-56099166 ACAGGTGAGCAAAGACTTGAAGG - Intergenic
1083777079 11:64899327-64899349 CTACGAGAGCAAAGTCCTGAAGG - Intronic
1084104239 11:66970597-66970619 AAACGTGAGCAAGGACAAGAGGG - Intergenic
1087883030 11:103441280-103441302 ACATTTGAGCAAAGACCTGAAGG - Intronic
1089278359 11:117355165-117355187 CCATGTCAGCAAAGACCTGGTGG - Intronic
1089957506 11:122585224-122585246 CCACGTGAGCAAAGGCAGGCAGG + Intergenic
1090011092 11:123046602-123046624 GCACGGAAGCAAAGGCCAGATGG - Intergenic
1090843068 11:130509301-130509323 CCACACCAGCAAAGGCCAGAGGG - Intergenic
1091017139 11:132062119-132062141 CCAAGTGAGGCAAAACCAGATGG - Intronic
1091077981 11:132639178-132639200 ACACGTGAGGAAAGAGCAGGCGG + Intronic
1092475796 12:8818096-8818118 CCTCATGAGCAGAGACCAGATGG - Intergenic
1098095829 12:66954976-66954998 CCACTTGAGCAAAGCCCCAAAGG + Intergenic
1098572391 12:72003088-72003110 CCAGGTAGGCAAAGACAAGAGGG - Intronic
1098589783 12:72197231-72197253 ATACTTGAGCAAAGACCTGAAGG - Intronic
1101260776 12:103027405-103027427 GCATTTGAGCAAAGACCTGAAGG - Intergenic
1101798799 12:108002532-108002554 GCATTTGAGCAAAGACCTGAAGG - Intergenic
1103398066 12:120623128-120623150 GCATTTGAGCAAAGACCTGAAGG - Intergenic
1103919136 12:124390413-124390435 TCACTTGAGCCAAGACCAGAGGG - Intronic
1103998129 12:124843040-124843062 CCTCTGGAGCAAAGACCAGCTGG + Intronic
1104291493 12:127473311-127473333 ACACATGAGCTAAGAGCAGAAGG + Intergenic
1105009862 12:132748452-132748474 ACAGGTGAGAAAAGACGAGAAGG + Intronic
1107799228 13:44088445-44088467 CCCCATGAGCAGAGACCCGAGGG - Intergenic
1109479290 13:62928190-62928212 CAACCTGTGCAAAGCCCAGAAGG + Intergenic
1110635379 13:77761436-77761458 CCATCTGAGCAAAGACCTGAGGG - Intronic
1110701320 13:78552150-78552172 ACATTTGAGCAAAGACCTGAAGG + Intergenic
1112111046 13:96299432-96299454 CCACCTGAGCAAAGTCTTGAAGG + Intronic
1112297639 13:98202289-98202311 CCAGGAGAGCAAAGAGCAAAGGG - Intronic
1115333145 14:32219673-32219695 CCATGTGAGCTAAGAGAAGAGGG - Intergenic
1115557156 14:34552889-34552911 CCAAGTCAGAAATGACCAGAGGG - Intergenic
1115559076 14:34566767-34566789 TAACGTGAAAAAAGACCAGAGGG + Intronic
1116464061 14:45212071-45212093 CAATGTGAGCAAAGCCCTGAGGG - Intronic
1117240223 14:53824672-53824694 GCATTTGAACAAAGACCAGAAGG - Intergenic
1122462332 14:101905826-101905848 ACATCTGAGCAAGGACCAGAGGG - Intronic
1125881138 15:43197050-43197072 CAACGTGAGCAGAGATCACAGGG - Exonic
1127322723 15:57863373-57863395 CCAGGTGAGCAAGGTCCACAGGG - Intergenic
1127869095 15:63055395-63055417 CTAGGTGAGCAAAGAGCTGAAGG + Intronic
1128846469 15:70901534-70901556 ACATTTGAGCAAAGACCTGAAGG - Intronic
1129139958 15:73588687-73588709 ACACGTAAGCCAAGACCTGATGG - Intronic
1130657100 15:85799290-85799312 ACATGTGAGCAGAAACCAGAAGG - Intergenic
1134008949 16:10836948-10836970 CCACGTGTGCAGAGATCACATGG - Intergenic
1134556713 16:15171974-15171996 ACATTTGAGCAAAGTCCAGAGGG - Intergenic
1134917294 16:18083687-18083709 ACATTTGAGCAAAGTCCAGAGGG - Intergenic
1136043726 16:27599872-27599894 GCACATGAGCACAGAGCAGAAGG - Intronic
1138781675 16:59796116-59796138 CCATCTGAGCAGAGACAAGAAGG - Intergenic
1141437881 16:84011047-84011069 CCCCATTAACAAAGACCAGAAGG + Intronic
1144761016 17:17707414-17707436 ACAGGTGAGCAAAGACTCGAGGG + Intronic
1147857515 17:43493514-43493536 TGTCGTGAGCAAAGGCCAGAGGG + Exonic
1147945298 17:44077280-44077302 CCAAGGGAGCTAAGACCAGGAGG - Exonic
1149220417 17:54410756-54410778 CCTTGTGAGCAAAGAACTGAAGG + Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151365015 17:73611546-73611568 CCATGTGAGCAGAGGCCACAGGG - Intronic
1151662022 17:75524325-75524347 CCACCAGGGCAAAGATCAGAGGG - Exonic
1152684306 17:81686620-81686642 CTGCGTGAGTAAACACCAGAAGG + Intronic
1156405216 18:36776723-36776745 ACACATGAGCCCAGACCAGAGGG + Intronic
1156460564 18:37319292-37319314 CCACGTGAGCGAAGCCCATGTGG - Intronic
1157524268 18:48367676-48367698 CCATGTCAGCAAAGGCCACATGG + Intronic
1161702024 19:5800834-5800856 CCACGTGGGCAGAGAGCAGGTGG + Intergenic
1162850963 19:13430871-13430893 ACACTTGAGCAAAGACCCAAAGG + Intronic
1162856515 19:13472670-13472692 CCACGTAAGTGAAGACCTGAAGG - Intronic
1166614825 19:44233981-44234003 ACATGTGAGCAGAGACCTGAAGG + Intronic
1167113707 19:47476597-47476619 CCACGTGAGCCATGGCCAGCAGG + Exonic
1167551110 19:50161691-50161713 GCATGTGAGAAAAGACCTGAAGG - Intronic
1168562711 19:57397050-57397072 CCACGTCCTCAAAGACCACACGG - Exonic
925822100 2:7809562-7809584 CCACGTTAGCAAAGACTTCATGG - Intergenic
926312540 2:11685135-11685157 ACATGTGAGCAAAGACTTGAAGG + Intronic
927609231 2:24521045-24521067 AGATGTGAGCAAAGACCTGAAGG - Intronic
929311616 2:40432499-40432521 ACACTTGAGCAAAGTCCTGAAGG + Intronic
929579635 2:43073628-43073650 CCACGCCAGCAAAGAACAAATGG - Intergenic
930596097 2:53390049-53390071 CCACATCAGCAAAGACCAAGTGG + Intergenic
932641614 2:73453080-73453102 CCATGTGAGTAAGTACCAGAGGG - Exonic
933442730 2:82334124-82334146 CCACGAGTGCAAATACAAGAGGG - Intergenic
933730504 2:85452608-85452630 ACATCTGAGCAGAGACCAGAAGG - Intergenic
933813652 2:86048949-86048971 CCATCTGGGCAAGGACCAGAGGG - Exonic
935155705 2:100482009-100482031 CCACATAAGCAAAGACTAAAGGG + Intronic
935720545 2:105975229-105975251 ACATTTGAGCAAAGACCTGAAGG - Intergenic
937261340 2:120588366-120588388 ACACCTGAGCAGAGACCTGAGGG + Intergenic
938308047 2:130267896-130267918 CCACGTGGGCAAAGGGCAGGGGG + Intergenic
938320658 2:130360069-130360091 CCATTTGAGCAAAGACCTGAAGG - Intronic
938574589 2:132592283-132592305 ACATTTGAGCAAAGACCTGAAGG + Intronic
939574850 2:143883471-143883493 ACGTGTGAGAAAAGACCAGAAGG - Intergenic
940249205 2:151655763-151655785 CCACGTGAGGAAAGGCTAGCAGG - Intronic
941827484 2:169916615-169916637 CCACATGTGCAAAGAGCAGGAGG - Intronic
942768409 2:179485282-179485304 CCACTTAAGCAAAGGGCAGAAGG - Intronic
943533529 2:189117623-189117645 ACATTTGAGCTAAGACCAGAAGG - Intronic
943772791 2:191736842-191736864 GTACGTGAGCAAGGACCAGCAGG + Intergenic
944852950 2:203738676-203738698 ACACTTGAGCAAGGACCTGAAGG - Exonic
1169150098 20:3282818-3282840 CCGCCTGAGCAGAGACCTGAAGG - Intronic
1169630407 20:7624750-7624772 CCACTGGAGCCAAAACCAGAAGG - Intergenic
1170898522 20:20437667-20437689 GCATTTGAGCAAAGACCTGAAGG - Intronic
1172008507 20:31833212-31833234 GCATGTGAACAAAGACCTGAAGG + Intronic
1172783765 20:37452392-37452414 CAGCTTGAGCAAAGGCCAGAAGG - Intergenic
1173969501 20:47140896-47140918 CAACGTGTGCAAAGATCACATGG + Intronic
1174110727 20:48196077-48196099 ACAGGTGAGCTAATACCAGAAGG - Intergenic
1174297653 20:49560628-49560650 CCACGTGAGCAAAGACCAGAAGG + Intronic
1174867694 20:54152847-54152869 GCAAGTGTGCAAAGAACAGAGGG + Intergenic
1175272452 20:57744097-57744119 CTATGTGGGAAAAGACCAGAAGG + Intergenic
1175571253 20:60024373-60024395 ACACGTGAGCAAATCCCAGTGGG - Intronic
1178928735 21:36798038-36798060 ACACGTGAGCAGAGACTTGAAGG + Intronic
1179421881 21:41242851-41242873 CCACGTCTGCAAAGGTCAGATGG - Intronic
1180071083 21:45436167-45436189 CCACGTGGGCATTCACCAGAGGG - Intronic
1180205134 21:46255206-46255228 ATATGTGAGCAAAGACCTGAAGG + Intronic
1180740630 22:18050939-18050961 CCACGTAAGCAGAGAAGAGATGG - Intergenic
1181457132 22:23066155-23066177 ACACTTGAGCAAAGACCTGGGGG + Intronic
1181721121 22:24775177-24775199 CCACGTGAGGAAAGAACGCAGGG - Intergenic
1181990242 22:26831799-26831821 CCACCTGGGCAAAGACCAGCAGG - Intergenic
1182732971 22:32510095-32510117 CCCCGTGAACAATGACCACATGG - Intergenic
1183827204 22:40397801-40397823 ACACCTGAGCAAAGACCAAAAGG - Intronic
1184333633 22:43840868-43840890 ACCCGTGAGCAAAGACCCCACGG - Intronic
1184383363 22:44160391-44160413 CCAGGTGAGGAAAGAATAGAGGG - Intronic
950647515 3:14386201-14386223 CCAACTGAGCCAAGCCCAGACGG - Intergenic
951002675 3:17581967-17581989 ACATGTGAGTAAAGACCTGAAGG - Intronic
951730853 3:25808753-25808775 ACATTTGAGCAAAGACCTGAAGG - Intergenic
952197381 3:31090309-31090331 CCAGAGGAGCAAAGAACAGATGG - Intergenic
953263009 3:41358518-41358540 ACATGTGAGTAAAGACCTGAAGG + Intronic
953447029 3:42977191-42977213 ACACTTGGGCAAAGACCTGAAGG + Intronic
953697421 3:45170903-45170925 CCACCTGAGCAAAGGCCTGGGGG - Intergenic
955344296 3:58149697-58149719 CCTCGTTTGCAAAGCCCAGAGGG - Intronic
956190498 3:66603197-66603219 CCAGGTGAGCAAAGGACAAAGGG + Intergenic
956379686 3:68652683-68652705 ACACTTGAGCAGAGACCTGAAGG + Intergenic
956903290 3:73739444-73739466 ACAAGGGAGCAAAAACCAGAAGG - Intergenic
957140957 3:76356270-76356292 ACAAGTGAGCAAAAAACAGATGG + Intronic
960259644 3:115552166-115552188 CGACAATAGCAAAGACCAGAGGG - Intergenic
960302370 3:116019297-116019319 ACACGTTAGCAAAGACCATGAGG + Intronic
960665334 3:120103585-120103607 CCAAGTGAGGAAACAGCAGATGG - Intergenic
961333394 3:126155992-126156014 CCACGTGAGCAAGAGCCTGAGGG + Intronic
962045270 3:131752259-131752281 CCATGCCAGCAAAGACCAGGTGG - Intronic
962152475 3:132907524-132907546 CAACATGAGCACAGACCAGCTGG - Intergenic
962445573 3:135461056-135461078 TCACCTGAGCAAGGTCCAGAAGG + Intergenic
962456212 3:135567863-135567885 ACAAATGACCAAAGACCAGATGG - Intergenic
964677290 3:159297822-159297844 TCATTTGAGCAAAGACCTGATGG - Intronic
966369559 3:179234021-179234043 ACATTTGAGCAAAGACCTGAAGG + Intronic
967409708 3:189154956-189154978 ACATTTGAGCAAAGACCTGAAGG + Intronic
968423336 4:503583-503605 CCACTTGAGCTGAGACCTGAAGG - Intronic
968617108 4:1582388-1582410 CCCCGCGGGGAAAGACCAGAAGG + Intergenic
969148001 4:5141289-5141311 ACATGTGAGCAGAGACCTGAAGG + Intronic
970621954 4:17831592-17831614 ACATTTGAGCAAATACCAGAAGG + Intronic
970758551 4:19455477-19455499 CCTCCTGAGCAAACAACAGACGG + Intergenic
970964128 4:21908348-21908370 ACACTTGAGCCAAGACCTGAAGG - Intronic
976768219 4:88620860-88620882 CCATGGGAGCAGAGACCTGAAGG - Intronic
977246293 4:94635732-94635754 CCAAGTGAGCAGAGACTAGGAGG + Intronic
978832889 4:113110632-113110654 CCAGGTGAAAAATGACCAGATGG + Intronic
979669482 4:123347104-123347126 CCATGTGTGCAAAGACGACATGG - Intergenic
980305440 4:131054795-131054817 CCTCCTGAGCAAACAACAGAGGG + Intergenic
980547579 4:134288163-134288185 CTACAAGAGCAAAGACCTGAAGG + Intergenic
981802811 4:148677909-148677931 CAACGTGAGCAGAGATGAGAGGG - Intergenic
981863180 4:149381602-149381624 ACATTTGAGCAAAGACCTGAAGG - Intergenic
982010364 4:151099907-151099929 CGACGCGCGCAAGGACCAGAAGG - Intronic
984609466 4:181821164-181821186 GAATGTGTGCAAAGACCAGAGGG - Intergenic
985772751 5:1823501-1823523 CCACGCCAGCAAAGGCCAGCGGG - Intergenic
986470863 5:8072923-8072945 CCAGGTGAACAATGACAAGAAGG + Intergenic
986588156 5:9340324-9340346 CCACATGAGGGAAGAACAGAGGG + Intronic
990383687 5:55238980-55239002 ACATTTGAGCAAAGACCTGAAGG + Intergenic
991511407 5:67380756-67380778 CCTCATCAGCAAAAACCAGATGG + Intergenic
999550244 5:152678563-152678585 TCATCTGAGCAAAGACCTGAAGG - Intergenic
1000044343 5:157509351-157509373 CCAACTGAGAAAGGACCAGAGGG + Exonic
1000901522 5:166917049-166917071 ACATGTGAGCAGAGACCTGAAGG - Intergenic
1001255956 5:170183770-170183792 CAAGGTGAGCAGAGGCCAGAGGG + Intergenic
1001464061 5:171946672-171946694 CCATTTGAGCAAAGACTTGAAGG - Intronic
1001583478 5:172816671-172816693 CCACATGAGCAAAGACATGGAGG + Intergenic
1002315738 5:178341882-178341904 GCATGTGAGCAAAGACGTGAAGG - Intronic
1006515510 6:34543593-34543615 CCATCTGAGCCAAGACCTGAAGG + Intronic
1006607067 6:35265607-35265629 ACATTTGAGCAAAGACCTGAAGG + Intronic
1011750124 6:90447047-90447069 CCAGGTGAGCCAAGACCTGTGGG + Intergenic
1011996137 6:93590405-93590427 GCATTTGAGCAAAGACCTGATGG - Intergenic
1012246954 6:96936909-96936931 ACATTTGAGCAAAGACCCGAAGG - Intronic
1013182505 6:107730231-107730253 ACTGGTGAGCAAACACCAGATGG + Intronic
1013341995 6:109224103-109224125 CCACTGAAACAAAGACCAGAAGG - Intergenic
1013570220 6:111415707-111415729 ACATCTGAGCAAAGACCTGAAGG - Intronic
1013725243 6:113087636-113087658 CCATGTTAACAAAGACCAAATGG + Intergenic
1018712929 6:166509599-166509621 CCAGATGAGCAAAGTACAGAAGG - Intronic
1022383346 7:29881095-29881117 CCACCTGAGCAGAGACCTGCAGG - Intronic
1024085352 7:45888040-45888062 CCAGGTGAGGAAAGGCGAGATGG - Intergenic
1029984425 7:104909868-104909890 CCACGTGTGAAAAAAGCAGAAGG + Intergenic
1033492861 7:141861621-141861643 ACACTTAAGCAAAGACCTGAAGG + Intergenic
1034075247 7:148225338-148225360 ACATGAGAGCAAAGACCTGAAGG + Intronic
1035185208 7:157121040-157121062 CCAGGTGAGCACAGCACAGATGG + Intergenic
1035775476 8:2184220-2184242 CCACCTGAGCAGAGTCCAGTGGG + Intergenic
1035975482 8:4305855-4305877 ACACGTAAGCAAAGACTGGAAGG - Intronic
1036611887 8:10357596-10357618 CAACGTGAGCCTATACCAGATGG - Intronic
1037345103 8:17890529-17890551 ATACCTGAGCAAAGACCTGAAGG - Intronic
1038225629 8:25654589-25654611 CCACTTGAGCAAAGACCAGAAGG - Intergenic
1038312172 8:26453130-26453152 CCACATGAGCCCAGGCCAGATGG - Intronic
1042521677 8:69718969-69718991 CCATTTGAGCAAAAACCTGAAGG + Intronic
1045226926 8:100256936-100256958 CCCCTTGAGCTGAGACCAGAAGG + Intronic
1046512739 8:115219865-115219887 CCAGGTGAACAAAGGCAAGAAGG + Intergenic
1047624857 8:126646373-126646395 CCACCTGTGCAAAGACCGGAAGG + Intergenic
1048823683 8:138402405-138402427 CCAGGTGTGTAAGGACCAGATGG + Intronic
1049190372 8:141284282-141284304 CCTCGAGAGCAAAGAACAGGTGG + Intronic
1049620460 8:143596118-143596140 ACCCGGGAGCAAAGCCCAGAGGG + Intronic
1050182849 9:2938941-2938963 GCATGTGAGCAAAGACCTGCAGG + Intergenic
1051063724 9:13076030-13076052 AAAAGTGAACAAAGACCAGATGG + Intergenic
1051322371 9:15921271-15921293 GCACTTGAGCCAAGACTAGAAGG - Intronic
1052983063 9:34463103-34463125 GCATATGAGCAAAGACCTGAAGG + Intronic
1053307896 9:36996735-36996757 CCACGGGAGCTATGGCCAGAGGG - Intronic
1057230913 9:93320777-93320799 CTCCGTGAGCAAAGGCCAGGAGG - Intronic
1058067687 9:100567296-100567318 ACACGTGAGTAAAGACTTGAAGG - Intronic
1058908995 9:109504093-109504115 ACACTTAAGCAAAGACCTGAAGG + Intergenic
1188040926 X:25369335-25369357 CCACATGAGCAAAGATCACTTGG - Intergenic
1188895179 X:35658892-35658914 CCACTTGTGCAAAGACCTGATGG - Intergenic
1189554667 X:42129749-42129771 ACACTTGAGCTGAGACCAGAAGG + Intergenic
1191650918 X:63537015-63537037 CCTCGTGGGCATAGACCACATGG + Intergenic
1194070124 X:89313241-89313263 CAACATCAGCAAAGACCACAGGG - Intergenic
1197694688 X:129538532-129538554 ACATTTGAGCAAAGACCTGAAGG + Intergenic
1198510789 X:137349533-137349555 CCACCTGAGCAAAGGTCAAATGG - Intergenic
1198710459 X:139495865-139495887 CCATTTGAGCGAAGACCTGAAGG - Intergenic
1200032340 X:153306844-153306866 TCACATGGGCAAAGGCCAGAAGG - Intergenic
1200179036 X:154139251-154139273 ACATGTGAGCAAAGACTCGAGGG - Intergenic
1200724360 Y:6648867-6648889 CAACATCAGCAAAGACCACAGGG - Intergenic