ID: 1174298639

View in Genome Browser
Species Human (GRCh38)
Location 20:49567132-49567154
Sequence GCTTCGGTCTTACCTATAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174298625_1174298639 27 Left 1174298625 20:49567082-49567104 CCAGAGAGGGAGAGAGGACTAGA 0: 1
1: 0
2: 2
3: 36
4: 376
Right 1174298639 20:49567132-49567154 GCTTCGGTCTTACCTATAACAGG 0: 1
1: 0
2: 0
3: 0
4: 28
1174298624_1174298639 28 Left 1174298624 20:49567081-49567103 CCCAGAGAGGGAGAGAGGACTAG 0: 1
1: 0
2: 3
3: 49
4: 347
Right 1174298639 20:49567132-49567154 GCTTCGGTCTTACCTATAACAGG 0: 1
1: 0
2: 0
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174298639 Original CRISPR GCTTCGGTCTTACCTATAAC AGG Intronic
902825836 1:18973614-18973636 TCTACGGTCTTATCAATAACAGG - Intergenic
909374590 1:74924740-74924762 GCTTCGGTTTTTCCCATATCTGG - Intergenic
911632110 1:100194726-100194748 GCTTCAGCCTCCCCTATAACTGG + Exonic
919905210 1:202073707-202073729 GCTTGGGTGTTACCTATACATGG + Intergenic
924600173 1:245481878-245481900 GCTCCAGTCTTACCTTTCACTGG + Intronic
1088228365 11:107646420-107646442 TTTTAGGTCTCACCTATAACAGG - Intronic
1094020972 12:25913840-25913862 GCTACGGTCTTGCCAATGACAGG - Intergenic
1096024850 12:48351286-48351308 GCCTCGGTCTGGCCTGTAACGGG - Intronic
1097235457 12:57536337-57536359 GCTTGTGTCTTACCTTCAACAGG - Intronic
1108300974 13:49075859-49075881 GCTCCAGTCCTACCTTTAACAGG + Intronic
926829687 2:16947935-16947957 GCTTCAGACTTACATATAAAGGG - Intergenic
936854914 2:116945752-116945774 GCTTTGGTCTGACCTGTAAGTGG - Intergenic
948769250 2:240239828-240239850 GCTTGGGTCTGATCTATAATAGG - Intergenic
1170631586 20:18071129-18071151 GCTTCAGTCTCCCCTATTACAGG + Intergenic
1174298639 20:49567132-49567154 GCTTCGGTCTTACCTATAACAGG + Intronic
1179655650 21:42842615-42842637 GCCTTGGCCTTACCTATACCAGG - Intergenic
960152560 3:114265042-114265064 GCTTAGGTCCTACTTATAAGTGG + Intergenic
960427513 3:117527088-117527110 CCTTAGGCTTTACCTATAACTGG - Intergenic
972767110 4:42161344-42161366 GCTTCAGCCTTACATATAGCTGG + Intergenic
975654050 4:76623198-76623220 TCTTCCTTCTTCCCTATAACAGG + Intronic
995992165 5:118253864-118253886 GCTTCCGTCTTTTTTATAACAGG + Intergenic
1007097287 6:39221342-39221364 GCTTCGGTCTTGTCCATAAGTGG - Intronic
1008795084 6:55293317-55293339 ACTTTGGACTTACCTATAAATGG + Intergenic
1012489199 6:99761708-99761730 GCCAAGGCCTTACCTATAACTGG + Intergenic
1022149152 7:27581423-27581445 GCTTCAGTTTTATCTACAACAGG + Intronic
1035831754 8:2702463-2702485 GCTACGATGTTACCTAAAACTGG + Intergenic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1048975056 8:139666851-139666873 GCTTGGGTCTTACCTTGAAGGGG - Intronic
1186069371 X:5801575-5801597 GCTTCTGTCTTCCCCATAAAGGG - Intergenic