ID: 1174298863

View in Genome Browser
Species Human (GRCh38)
Location 20:49568105-49568127
Sequence GGCCCAAGCCATCGCGGGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174298858_1174298863 -4 Left 1174298858 20:49568086-49568108 CCAGGAGGCCGAGGAGCGCGGCC 0: 1
1: 0
2: 4
3: 41
4: 300
Right 1174298863 20:49568105-49568127 GGCCCAAGCCATCGCGGGGCTGG 0: 1
1: 0
2: 1
3: 11
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174298863 Original CRISPR GGCCCAAGCCATCGCGGGGC TGG Exonic
900283788 1:1890066-1890088 GGCCCATTCATTCGCGGGGCCGG + Intronic
900514974 1:3077341-3077363 AGCCCAGGCCAGCGTGGGGCTGG - Intronic
903945589 1:26960303-26960325 GGCGCAAGCCAGGGCGGCGCCGG - Intronic
904647403 1:31978138-31978160 GTCACCAGCCATCACGGGGCTGG - Intergenic
905517170 1:38570268-38570290 GGCCTCACCCACCGCGGGGCAGG + Intergenic
914845588 1:151282159-151282181 GGGCCAACCCAGTGCGGGGCTGG + Intronic
923084646 1:230694323-230694345 GGCCCAAGCCACAGCTAGGCGGG - Intergenic
1063374489 10:5545943-5545965 GGCCCAAGCCACCCAGGGACTGG - Intergenic
1066760218 10:38741981-38742003 GGCCAAGGCCAAGGCGGGGCAGG - Intergenic
1067229474 10:44396531-44396553 TGCACAAGCCATCTCAGGGCAGG + Intergenic
1068657187 10:59587864-59587886 AGCCCAAGCCCTCTTGGGGCTGG - Intergenic
1070179317 10:73998725-73998747 GGGCGAAGCCTGCGCGGGGCAGG - Intronic
1075063477 10:119273107-119273129 GGCTTAAGCCATCGCCGGTCTGG - Intronic
1075409127 10:122214515-122214537 GGACCAACCCATGGAGGGGCTGG + Intronic
1075733496 10:124650278-124650300 GGCCCAGGTCATCGCGGGACAGG + Intronic
1075747964 10:124741407-124741429 GGCCCAAGGCATCGAGCGGTGGG + Intronic
1076227754 10:128793948-128793970 GGCCAAAGCCCTCACTGGGCTGG - Intergenic
1076809140 10:132877748-132877770 GGCACAGGCCATCCCGGGCCCGG + Intronic
1077661156 11:4069702-4069724 TGCCCCAGCCATCTCTGGGCTGG - Intronic
1078457516 11:11486774-11486796 GGACAAAGCCATCCCGGGACTGG - Intronic
1081679993 11:44995409-44995431 AGCCCAAGCCATCCCAGGGCAGG + Intergenic
1083253849 11:61484723-61484745 GCCTCAGGCCATCACGGGGCTGG + Exonic
1083945223 11:65919577-65919599 GGCCCAAGCCACCCGGGAGCCGG - Intronic
1084106521 11:66984267-66984289 GGCCAGAGCCATGGCAGGGCTGG + Intergenic
1084401807 11:68948426-68948448 GTCCCAAGGCATAGCTGGGCGGG - Intergenic
1084538729 11:69774138-69774160 GGCGCAGGTCATTGCGGGGCAGG + Intronic
1090784061 11:130032989-130033011 GGCCCCAGCCACAGTGGGGCTGG - Intergenic
1092166781 12:6347461-6347483 GGCTTAAGCCGTCGCTGGGCAGG + Exonic
1093882067 12:24416138-24416160 GGCCCAAGCAAGAGCGGGGCAGG + Intergenic
1098080610 12:66780951-66780973 GGCCCAAGACAGCGTGGAGCAGG + Intronic
1104049756 12:125187172-125187194 GGCCCAAGGCAGGGCGGGGAGGG - Intronic
1104854162 12:131894479-131894501 GGGCCGGGCCATTGCGGGGCCGG - Intergenic
1105409570 13:20160830-20160852 GGCCGAGGGCAGCGCGGGGCGGG - Intronic
1107549164 13:41458521-41458543 GGCCGCAGCCTTCGCGGGGCAGG - Intronic
1114736595 14:25049516-25049538 GGCCCATGCCATCGCGGGGACGG + Intronic
1116811608 14:49545098-49545120 GGCACAAGCCCTCGCTGGGCAGG - Intergenic
1119998566 14:79278873-79278895 CGCCCAAGCCACCGCCAGGCAGG + Intronic
1129393760 15:75233492-75233514 GGCCCAAGGTATCTCGGGTCTGG - Intergenic
1131215212 15:90530280-90530302 GGCCAAGGCGATGGCGGGGCCGG + Intronic
1132601282 16:774319-774341 GGCCCACGGCCTGGCGGGGCAGG + Exonic
1132987495 16:2775463-2775485 GGCCCCAGCCACAGTGGGGCTGG - Exonic
1133218523 16:4307840-4307862 GGCCCAAGCCTCCGCCGGGGCGG - Intergenic
1134128300 16:11631350-11631372 GGCTCCAGGCATCCCGGGGCTGG + Intronic
1136707194 16:32200640-32200662 GGCCCAGGCAAGCGCAGGGCTGG - Intergenic
1136722577 16:32337295-32337317 GGCCAAGGCCAAGGCGGGGCAGG + Intergenic
1136760716 16:32728777-32728799 GGCCCAGGCAAGCGCAGGGCTGG + Intergenic
1136775346 16:32868774-32868796 GGCCCAAGCCATGGCTGTCCAGG - Intergenic
1136807387 16:33141609-33141631 GGCCCAGGCAAGCGCAGGGCTGG - Intergenic
1139420159 16:66844867-66844889 GGCCCAGGGCAGCGGGGGGCGGG + Intronic
1142001440 16:87666627-87666649 GGCTCAAGCCAGAGAGGGGCTGG + Intronic
1203003854 16_KI270728v1_random:180469-180491 GGCCAAGGCCAAGGCGGGGCAGG - Intergenic
1203062868 16_KI270728v1_random:989091-989113 GGCCCAGGCAAGCGCAGGGCTGG + Intergenic
1203077763 16_KI270728v1_random:1130883-1130905 GGCCCAAGCCATGGCTGTCCAGG - Intergenic
1203135462 16_KI270728v1_random:1716876-1716898 GGCCAAGGCCAAGGCGGGGCAGG - Intergenic
1142711224 17:1724962-1724984 GGCCCAGGGCAGCGGGGGGCGGG + Exonic
1143119866 17:4599906-4599928 GGCCCAGGCCACCGGGAGGCGGG - Intronic
1143711991 17:8741724-8741746 GGCCCAGGCCTTCCTGGGGCTGG + Intronic
1144991648 17:19237639-19237661 GGCGCATGCCCTGGCGGGGCTGG - Intronic
1145190973 17:20842080-20842102 GGCCCAGGCAAGCGCAGGGCTGG - Intronic
1152360948 17:79832735-79832757 GGCGCAAGCCCTGGCGGGGCAGG - Intergenic
1152855507 17:82663096-82663118 GGGCCATGCCCTCGCTGGGCTGG - Intronic
1160978979 19:1807787-1807809 GGTCCAGGCCAGCGTGGGGCCGG - Intronic
1160995229 19:1879343-1879365 GGCCCAGGCAAGCGCAGGGCTGG + Intronic
1164979646 19:32604144-32604166 GGCCCTTGGCATCGCCGGGCTGG - Intronic
1166865151 19:45831472-45831494 GGGCCAAGCCATCTCGGTGGTGG - Exonic
1166944037 19:46386278-46386300 GGCCCTGCCCATGGCGGGGCCGG + Intronic
1167605522 19:50479842-50479864 GACCCACTCCATCGCTGGGCTGG + Intronic
925449731 2:3958710-3958732 GGCTCAAGCCAGTGTGGGGCTGG + Intergenic
932343015 2:70978635-70978657 CGCGGAGGCCATCGCGGGGCTGG - Exonic
934323537 2:91986322-91986344 GGCCAAGGCCAAGGCGGGGCAGG - Intergenic
941243208 2:163067819-163067841 GCCCAAAGCCCTCTCGGGGCCGG + Intergenic
941929883 2:170929107-170929129 GGCCCGAGCGCTCGCGGGCCGGG - Exonic
944058425 2:195547330-195547352 GGCCCATGGCAGCGCGGGACTGG - Intergenic
946401677 2:219471788-219471810 GGCCCATGCCATCCCGGGCCTGG - Intronic
946407364 2:219498742-219498764 TGACCAAGGGATCGCGGGGCGGG - Intergenic
1170623637 20:18014138-18014160 GGTCCCAGCCATGGTGGGGCAGG + Intronic
1174298863 20:49568105-49568127 GGCCCAAGCCATCGCGGGGCTGG + Exonic
1180550296 22:16532193-16532215 GGCCAAGGCCAAGGCGGGGCAGG - Intergenic
1181121302 22:20669883-20669905 GGCCCAGGCAAGCGCAGGGCTGG + Intergenic
1181334258 22:22116908-22116930 GGCCCAGGCAAGCGCAGGGCTGG + Intergenic
1185165288 22:49258216-49258238 GGCCTGAGCCAGCCCGGGGCAGG - Intergenic
954649844 3:52154361-52154383 GGGCGCAGCCATGGCGGGGCTGG + Exonic
955256171 3:57333679-57333701 GACCAAAGACATCGTGGGGCTGG + Intronic
955644970 3:61127234-61127256 GGCCCAAGCCATAGTGGTGGAGG + Intronic
961175089 3:124828714-124828736 GGCTCAAGCCATCGCAGTGCTGG + Intronic
968612248 4:1562645-1562667 GGCCCACGCCAGCCCTGGGCTGG - Intergenic
979649691 4:123115116-123115138 GCTCCAGGCCATCGCTGGGCTGG + Intronic
981615236 4:146638418-146638440 GGCCCAAGCCAGCGTTGGGTAGG - Intergenic
983011960 4:162558392-162558414 GGCACAATCCATGGCTGGGCTGG - Intergenic
987529769 5:19102432-19102454 GGCCTAAGCAATCGCAAGGCTGG - Intergenic
987678473 5:21106142-21106164 GGCACAATCCATGGCTGGGCTGG - Intergenic
992781976 5:80136163-80136185 GGCCCAAGCCCTCGGGAGGCTGG + Intronic
1002075598 5:176706421-176706443 GGCCTAGGCCACTGCGGGGCGGG + Intergenic
1002182804 5:177440293-177440315 GTCCCAGGTCATCGCAGGGCGGG + Intronic
1003034318 6:2629852-2629874 GGCTCATGCCATTGTGGGGCTGG - Intronic
1007392101 6:41555444-41555466 GGGCCAAGGCATGTCGGGGCAGG + Intronic
1017889041 6:158624445-158624467 GGCCGGAGCCATCGAGGAGCGGG + Intronic
1019305118 7:330488-330510 GGCCCAAGACATTGTGGGGGAGG + Intergenic
1019367740 7:643942-643964 GGTCCCAGACATCGCGGGGCAGG + Intronic
1019989508 7:4682101-4682123 GGCGCGCGCCAGCGCGGGGCTGG - Intergenic
1020283643 7:6664115-6664137 AGCCCAAGCCTCCGCGGGGAAGG - Intergenic
1023545290 7:41312077-41312099 GGCCCAAGCCACCCCAGGGAGGG - Intergenic
1023569975 7:41561671-41561693 TGCCCAAGCCATGGCCAGGCAGG - Intergenic
1035202470 7:157276317-157276339 GGCCCTGGCCACTGCGGGGCAGG + Intergenic
1035453728 7:158996208-158996230 GCCCGGAGCCATCGCGGGCCTGG + Intergenic
1036789614 8:11709068-11709090 GGCAGAAGCCAGTGCGGGGCTGG + Intronic
1045402635 8:101834350-101834372 GGCCCAAGCCAATGCGAGCCAGG + Intronic
1047951489 8:129939439-129939461 GGCCCGGGGCGTCGCGGGGCCGG + Intronic
1049614819 8:143571530-143571552 GGCATGAGTCATCGCGGGGCTGG + Intronic
1049803037 8:144527008-144527030 GGCCCGAGCAGTCGCCGGGCTGG + Exonic
1050406523 9:5314372-5314394 AGCTCAAGCCTTCACGGGGCAGG - Intergenic
1053141319 9:35684653-35684675 GGCCCAAGGCAGGGAGGGGCTGG - Intronic
1057068053 9:92073417-92073439 GGCCCAAGGCATAGCCAGGCAGG + Intronic
1061365749 9:130171966-130171988 TGCCCCAGCCCTCGCAGGGCGGG - Intergenic
1061670379 9:132185106-132185128 GGCCCCAACCAAGGCGGGGCAGG + Intronic
1061807667 9:133145385-133145407 GGCCCAGGCCATGCCGGGGCGGG - Intronic
1062022312 9:134325494-134325516 GGCCCGAGCTGTCCCGGGGCAGG + Intronic
1195068768 X:101260231-101260253 TGCCCAAGGCTTTGCGGGGCTGG + Intronic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic