ID: 1174299137

View in Genome Browser
Species Human (GRCh38)
Location 20:49568964-49568986
Sequence CCTAACGTGCACCAGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174299137_1174299143 -9 Left 1174299137 20:49568964-49568986 CCCTCTACCTGGTGCACGTTAGG No data
Right 1174299143 20:49568978-49569000 CACGTTAGGGCCTCCGGATGTGG No data
1174299137_1174299150 22 Left 1174299137 20:49568964-49568986 CCCTCTACCTGGTGCACGTTAGG No data
Right 1174299150 20:49569009-49569031 GTCATCGCTACCTGGTGCTTGGG No data
1174299137_1174299149 21 Left 1174299137 20:49568964-49568986 CCCTCTACCTGGTGCACGTTAGG No data
Right 1174299149 20:49569008-49569030 TGTCATCGCTACCTGGTGCTTGG No data
1174299137_1174299151 23 Left 1174299137 20:49568964-49568986 CCCTCTACCTGGTGCACGTTAGG No data
Right 1174299151 20:49569010-49569032 TCATCGCTACCTGGTGCTTGGGG No data
1174299137_1174299144 -6 Left 1174299137 20:49568964-49568986 CCCTCTACCTGGTGCACGTTAGG No data
Right 1174299144 20:49568981-49569003 GTTAGGGCCTCCGGATGTGGTGG No data
1174299137_1174299147 14 Left 1174299137 20:49568964-49568986 CCCTCTACCTGGTGCACGTTAGG No data
Right 1174299147 20:49569001-49569023 TGGCCATTGTCATCGCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174299137 Original CRISPR CCTAACGTGCACCAGGTAGA GGG (reversed) Intergenic
No off target data available for this crispr