ID: 1174309018

View in Genome Browser
Species Human (GRCh38)
Location 20:49635942-49635964
Sequence CAGGCTCCACGGCAGGACCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 316}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174309011_1174309018 6 Left 1174309011 20:49635913-49635935 CCAAGAGGCTCCAAGGTCATGTG 0: 1
1: 0
2: 1
3: 8
4: 151
Right 1174309018 20:49635942-49635964 CAGGCTCCACGGCAGGACCACGG 0: 1
1: 0
2: 0
3: 25
4: 316
1174309014_1174309018 -4 Left 1174309014 20:49635923-49635945 CCAAGGTCATGTGTAGGGACAGG 0: 1
1: 0
2: 0
3: 9
4: 151
Right 1174309018 20:49635942-49635964 CAGGCTCCACGGCAGGACCACGG 0: 1
1: 0
2: 0
3: 25
4: 316
1174309008_1174309018 21 Left 1174309008 20:49635898-49635920 CCTCTGCTCTGAAGGCCAAGAGG 0: 1
1: 0
2: 6
3: 19
4: 242
Right 1174309018 20:49635942-49635964 CAGGCTCCACGGCAGGACCACGG 0: 1
1: 0
2: 0
3: 25
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174309018 Original CRISPR CAGGCTCCACGGCAGGACCA CGG Exonic
900623518 1:3598056-3598078 CAGGCTGCAGGGCAGGCCCGGGG - Intronic
900625543 1:3606965-3606987 CAGGCTGCACAGCAGGCCCCAGG - Intronic
901642131 1:10697986-10698008 AAGGCACCACGGCATGGCCACGG + Intronic
901820919 1:11828886-11828908 CAAGCTGCTCGGCAGGGCCACGG - Intronic
901884026 1:12210179-12210201 CAGGCTGGAGGACAGGACCATGG - Intergenic
904384851 1:30134581-30134603 CAGGATTCAGGGCAGGAGCAGGG - Intergenic
907249585 1:53129386-53129408 AAGGCTACAGGGCAGGAACAGGG - Intronic
912181126 1:107220279-107220301 CAGGCTCCATGGGAGAGCCAAGG - Intronic
913129722 1:115828687-115828709 CAGCCTACACGCCAGGCCCAGGG - Intergenic
913958571 1:143323025-143323047 CAGGTTCCAGGCCAGGGCCAGGG + Intergenic
914000832 1:143692753-143692775 CAGGCTACACTGCAGGGCCTGGG + Intergenic
914052888 1:144148405-144148427 CAGGTTCCAGGCCAGGGCCAGGG + Intergenic
914126309 1:144818136-144818158 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
914383677 1:147146173-147146195 CAGACTCCACTGCAGAATCAGGG - Intergenic
917802099 1:178580673-178580695 CAGGGTCCAGGCCAGGAACAAGG - Intergenic
917919972 1:179743267-179743289 GAGGCTCCACGCCCGGAGCAGGG + Exonic
919817247 1:201449197-201449219 CAGGCTGCCCAGCAGGACAAGGG - Intergenic
919905454 1:202075495-202075517 CAGGAGCCAGGGCAGGACAACGG - Intergenic
920183928 1:204149056-204149078 CAGGCTCCACAGCATTCCCAGGG + Intronic
920376356 1:205510469-205510491 TGGGCTCCACGGCAGGATCAGGG - Intronic
922698441 1:227743683-227743705 CAGGCACCAAGGGAGGTCCAGGG - Intronic
923144038 1:231185447-231185469 CAGCCCCCAGTGCAGGACCAGGG + Intronic
924384731 1:243490396-243490418 CACGCTCCATGGCAGGGCCCTGG + Intronic
1063056029 10:2505340-2505362 CAGGTTGCACTGCAGAACCAGGG + Intergenic
1066759092 10:38737551-38737573 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
1066962535 10:42235219-42235241 CAGGTTCCAGGCCAGGGCCAGGG + Intergenic
1067215569 10:44300006-44300028 CATGCCCCACTGCAGAACCAAGG + Intergenic
1067235622 10:44446177-44446199 CAGGCTGCACGGCAGGAGGTGGG - Intergenic
1067533679 10:47092711-47092733 CAGGCTTCATGGCATGGCCAGGG - Intergenic
1070890793 10:79941234-79941256 CAGGCTGGAAGGCAGGAGCATGG - Intronic
1071502392 10:86213105-86213127 CAGGCTCCAAGGCAGGAGGTGGG - Intronic
1071730092 10:88239292-88239314 CAAGATCCACAGCAGGACAAAGG - Intergenic
1075078555 10:119367953-119367975 CAGGCGCCTCGGCAGGGCCAGGG + Intronic
1075657188 10:124169720-124169742 CTGGCTCCAATGCAGGGCCAGGG + Intergenic
1076177534 10:128379587-128379609 CAGGCTCCACAGCGGGGCAAAGG - Intergenic
1076273678 10:129178386-129178408 CAGGATGCTGGGCAGGACCATGG - Intergenic
1076738794 10:132470769-132470791 CCGCCTCCGCGGCAGTACCAGGG - Intergenic
1076799423 10:132813713-132813735 CAGGCTCCACGCCAGGGGCGGGG - Intronic
1077330612 11:1982425-1982447 GAGGCTCCAGGGCAGGGTCAGGG + Intronic
1078469575 11:11576228-11576250 CTGACTCCAGGGCAGGACCTTGG + Intronic
1080701697 11:34649780-34649802 CAGGCTCCCAGGCATGAACATGG - Intronic
1080723179 11:34869536-34869558 CAGGCACCACGGGAGGTCCATGG - Intronic
1083223304 11:61267593-61267615 CAGGCTTCCCGCCAGGGCCAAGG + Intronic
1083633252 11:64106429-64106451 CAGGCTCCATGCCAGGCACAAGG + Intronic
1083750817 11:64759638-64759660 CAGGCTCCCCAGCAGCACCTTGG + Exonic
1084150311 11:67285061-67285083 CAGGCTCTGCTGCAGGGCCAGGG - Exonic
1084168708 11:67389909-67389931 AAGGCTCCACGGAAGGGGCAAGG + Intronic
1084678213 11:70649225-70649247 CAGTCTCCATGGCAGGACCTAGG - Intronic
1084778883 11:71396083-71396105 CTGGCCCCACAGCAGGCCCACGG + Intergenic
1087841502 11:102925332-102925354 CAGGCCCCTCAGCAGGATCAAGG + Intergenic
1091329152 11:134717006-134717028 CAGGCTCCAGTGAAGGATCATGG + Intergenic
1202813590 11_KI270721v1_random:37604-37626 GAGGCTCCAGGGCAGGGTCAGGG + Intergenic
1091461530 12:646912-646934 CAGGCTCCACGCCAGGAGAATGG - Intronic
1092901451 12:13063254-13063276 CAGGCTCCACGGCTTGCCCAAGG - Intronic
1093075025 12:14749102-14749124 CAGCCTCCATACCAGGACCAGGG + Intergenic
1093731186 12:22567756-22567778 CAGGCCCCACGGCAGCATCCAGG + Intergenic
1094100880 12:26761059-26761081 CAGGCTTCAGGCCAGGCCCATGG + Intronic
1094470153 12:30795742-30795764 CAGGCTCCTCGGCAGCATTATGG + Intergenic
1095295523 12:40523101-40523123 CAGGCATCACTGCAGCACCAGGG + Intronic
1097180998 12:57171901-57171923 CAGGCTGGAGGGCAGGGCCAGGG - Intronic
1098803528 12:74992221-74992243 CAGACCACACAGCAGGACCAGGG + Intergenic
1098820426 12:75221024-75221046 CAGCCTCCTCTCCAGGACCAGGG + Intergenic
1100071374 12:90723761-90723783 GAGGCTTGATGGCAGGACCAGGG - Intergenic
1102466928 12:113135500-113135522 CAGGTTCCGAGGCTGGACCAGGG + Exonic
1103732799 12:123039074-123039096 AAGGCCCCAGGGCAGGAACATGG + Intronic
1105745995 13:23377392-23377414 CAGGCTCCACGGAAAAACCGAGG - Intronic
1106108822 13:26759713-26759735 CTGGCTCTACGGCAGGAACCCGG + Exonic
1106877072 13:34085787-34085809 CAGGGTACATGTCAGGACCAAGG - Intergenic
1107951399 13:45465262-45465284 CGGGCGCCCCGGCAGGACCCCGG + Intronic
1110728482 13:78853091-78853113 TAGGCTCCAGGCCAGTACCAGGG + Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1118745050 14:68767493-68767515 CAGGCTCCACAGTAGGGACAGGG - Intergenic
1120825120 14:88948039-88948061 CAGGCACACCGGCAGGGCCATGG + Intergenic
1121733888 14:96204900-96204922 CAGGCTGCCCCGCAGTACCAGGG + Exonic
1122208438 14:100159828-100159850 GGGGCTCCCCGGCAGGACCGAGG + Exonic
1122312220 14:100804444-100804466 CAGCCTCCCCGTCAGGTCCAGGG - Intergenic
1122694851 14:103547542-103547564 CAGGCTGGACGGCTGGAGCAAGG - Intergenic
1122935497 14:104954178-104954200 CAGGCTCCATGGAAAGACCCTGG - Exonic
1122940951 14:104981161-104981183 CAGGCTGAGGGGCAGGACCAGGG - Intergenic
1123113157 14:105882337-105882359 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123115507 14:105892489-105892511 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123119756 14:105911205-105911227 CAGGCTGCAGGGAAGGACCAGGG - Intergenic
1202929835 14_KI270725v1_random:27155-27177 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
1123422468 15:20144078-20144100 CAGGTTCCAGGCCAGGGCCAGGG + Intergenic
1123531696 15:21150618-21150640 CAGGTTCCAGGCCAGGGCCAGGG + Intergenic
1123739964 15:23226523-23226545 CAGGCTCCACAGCAGTCCCAAGG + Intergenic
1124055853 15:26240488-26240510 CAGGCCCCACACCAGGCCCACGG - Intergenic
1124291188 15:28455491-28455513 CAGGCTCCACAGCAGTCCCAAGG + Intergenic
1127763296 15:62162658-62162680 CAAGCTCCACTCCAGGAGCAGGG + Intergenic
1128161094 15:65423107-65423129 CAGGGTCCCCGGCGGGGCCAGGG - Intergenic
1128529137 15:68432046-68432068 CAGGCCCCTGGGCAGGTCCATGG + Exonic
1129250238 15:74304695-74304717 CAGGCTCCCCGCCAGCTCCAGGG - Intronic
1129600835 15:76997066-76997088 CAGCCTCCATGGCAGGATCTGGG + Intronic
1130508691 15:84570598-84570620 CAGGCTCCACTGCAACATCACGG - Intergenic
1132682518 16:1149006-1149028 CTGACTCCATGGCAGGACAAAGG + Intergenic
1132797507 16:1732510-1732532 CAGGCTCCACGGCACGCCCCTGG - Intronic
1132904744 16:2276848-2276870 CAGGCTCCTCTGCGGGACCTGGG + Intronic
1132913641 16:2329618-2329640 CAGGCTGCAGGGCAGTACCAGGG + Intronic
1133201611 16:4207457-4207479 CAGGCTCCTCGCCAGGCCCAGGG + Intronic
1133603830 16:7366537-7366559 CAGCCTCCATGGTTGGACCAGGG - Intronic
1136718228 16:32301655-32301677 CAAGGGCCATGGCAGGACCAGGG + Intergenic
1136718674 16:32303272-32303294 CAGGTTCCAGGCCAGGGCCAGGG + Intergenic
1136723702 16:32341636-32341658 CAGGTTCCAGGCCAGGGCCAGGG + Intergenic
1136836602 16:33507925-33507947 CAAGGGCCATGGCAGGACCAGGG + Intergenic
1136837045 16:33509536-33509558 CAGGTTCCAGGCCAGGGCCAGGG + Intergenic
1136842033 16:33547680-33547702 CAGGTTCCAGGCCAGGGCCAGGG + Intergenic
1136862283 16:33711271-33711293 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
1137391584 16:48085862-48085884 CAGGCACCAGGGAAAGACCAGGG + Intronic
1138214478 16:55191216-55191238 CAGGCTCTACGGGAGCAGCAAGG - Intergenic
1139348396 16:66319970-66319992 CTTGCTCCATGGCAGGACCATGG - Intergenic
1139950180 16:70664704-70664726 CAGGCCCCGCGTCAGCACCATGG + Exonic
1139955111 16:70689482-70689504 CAGCCTGCTGGGCAGGACCAGGG + Intronic
1141614158 16:85200965-85200987 CAGGCTCCAAGCCTGGAGCAGGG + Intergenic
1141624289 16:85253262-85253284 CAGACTCCAGGGCAGGACTGGGG - Intergenic
1141772095 16:86095766-86095788 TAGGCCCCAAGCCAGGACCAAGG - Intergenic
1203002729 16_KI270728v1_random:176129-176151 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
1203007757 16_KI270728v1_random:214499-214521 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
1203008200 16_KI270728v1_random:216110-216132 CAAGGGCCATGGCAGGACCAGGG - Intergenic
1203123776 16_KI270728v1_random:1559454-1559476 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
1203124202 16_KI270728v1_random:1561037-1561059 CTGGGTCCAGGGCAGGGCCAGGG - Intergenic
1203124562 16_KI270728v1_random:1562276-1562298 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
1203134335 16_KI270728v1_random:1712535-1712557 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
1203146789 16_KI270728v1_random:1808226-1808248 CAAGGGCCATGGCAGGACCAGGG + Intergenic
1203147222 16_KI270728v1_random:1809815-1809837 CAGGTTCCAGGCCAGGGCCAGGG + Intergenic
1203152198 16_KI270728v1_random:1847977-1847999 CAGGTTCCAGGCCAGGGCCAGGG + Intergenic
1142968436 17:3595422-3595444 CAGACTCCACAGCAGGGCCTGGG + Intronic
1144570021 17:16391661-16391683 CAGGCTCCTCTCCAGGGCCAAGG - Intergenic
1144624350 17:16837150-16837172 CAGGCTTCAGGGCAGGAGGAAGG + Intergenic
1144882077 17:18435570-18435592 CAGGCTTCAGGGCAGGAGGAAGG - Intergenic
1145150156 17:20508816-20508838 CAGGCTTCAGGGCAGGAGGAAGG + Intergenic
1145362170 17:22221447-22221469 CAGGCTCCTCTCCAGGGCCAGGG - Intergenic
1146162087 17:30565461-30565483 CAGGCTTCAGGGCAGGAGGAAGG + Intergenic
1146255688 17:31390753-31390775 CAGGCTCTAGGTCAGGACCCTGG - Intergenic
1147578486 17:41615871-41615893 CAGGCTTCAGGGCAGGAGGAAGG + Intronic
1147819702 17:43234414-43234436 GAGGCTCCAGGGCAGGAGCGCGG + Intergenic
1148152466 17:45404751-45404773 CAGGTTCCAAGACAGCACCAGGG + Intronic
1148236201 17:45970832-45970854 AAGACTCCAGGGCAGGCCCATGG - Intronic
1151092173 17:71453974-71453996 CAGGCCCCACTGCAGAACTATGG + Intergenic
1151344410 17:73492837-73492859 CAGGCGCCACGGCAGCCCCCAGG + Intronic
1151569719 17:74920202-74920224 CACGCTGCACGGCACGGCCAGGG - Exonic
1151595719 17:75077140-75077162 CAGCCTCCAGGGCAGGACGCTGG - Intergenic
1152015318 17:77746897-77746919 CAGGTGCCACAGCAGGAACAAGG - Intergenic
1152726308 17:81948425-81948447 CAGGCTGTCCTGCAGGACCAGGG - Intergenic
1152962736 18:89435-89457 CAGGCTCCCCAGCAGGTCTAGGG - Intergenic
1154415545 18:14173708-14173730 CAGGTTCCAGGCCAGGTCCAGGG + Intergenic
1155839448 18:30628606-30628628 CAGGCTGCAGGGCTGGACCTCGG + Intergenic
1157311282 18:46555346-46555368 CAGACTCCAGGTCAGGACCCTGG + Intronic
1158411347 18:57208652-57208674 CAGGCTCCATGGCTGGCACATGG + Intergenic
1158420184 18:57286353-57286375 CACGCCCCAAGGCAGCACCAGGG + Intergenic
1161443242 19:4304424-4304446 GAGGTCCCACGGCAGGGCCAGGG + Intergenic
1163374092 19:16919829-16919851 CAGGCTCCCTGGCAGGATCTTGG + Intronic
1163476390 19:17528534-17528556 CAGGCCCCTCGGTAGGACCCTGG + Intronic
1164462281 19:28459200-28459222 AAGGATCCAGGGCAGGCCCATGG + Intergenic
1164593015 19:29516530-29516552 CAGGCCCCACGTCAGCACCAAGG + Intergenic
1164850455 19:31478831-31478853 CAGGGTCCAGGGAAGGATCAGGG + Intergenic
1165266182 19:34665062-34665084 CAGGGCCCAGGGCAGGTCCAGGG - Intronic
1165273810 19:34732120-34732142 CAGGGCCCAGGGCAGGTCCAGGG - Intergenic
1167001096 19:46746224-46746246 CAGGATCCCCGGCAGGCTCAGGG + Exonic
1168182349 19:54670958-54670980 AAGGCTTCAGGGCAGGACCATGG + Intronic
1202692285 1_KI270712v1_random:100829-100851 CAGGTTCCAGGCCAGGGCCAGGG + Intergenic
925024881 2:599815-599837 CAGAGTCCACAGCAGGACCTGGG - Intergenic
925123730 2:1438964-1438986 CAGGCTCTACTGCAGGACCCAGG - Intronic
925283179 2:2699085-2699107 CAGGCTTCAGGACAGGAGCACGG + Intergenic
925975461 2:9138980-9139002 CAGGCTCCCCCGCTGGGCCAGGG + Intergenic
926112931 2:10194367-10194389 GAGGAGGCACGGCAGGACCAAGG - Intronic
926251437 2:11157378-11157400 CAGCCTCCAAGCCAGGGCCAGGG + Intronic
926836851 2:17032509-17032531 CAGGCACCAGGGCAGGAGGATGG + Intergenic
927289427 2:21390886-21390908 CAAGCTCCAAGGCAGTGCCAAGG + Intergenic
927387006 2:22546239-22546261 CAGGCTCCAATGCAGGCCCAAGG + Intergenic
928262238 2:29778371-29778393 CAGGCTCCAAGGAAGGGTCATGG + Intronic
932430728 2:71672362-71672384 CTGGCTCCGTGGCAGGCCCAGGG - Intronic
932433767 2:71691070-71691092 CAGGCACCAGGGCAGGACAGGGG - Intergenic
932761259 2:74440497-74440519 CCGCCTCCACGCCAGGCCCACGG + Intronic
933777622 2:85780461-85780483 CAGGCCCCAGGTCAGGAGCAAGG - Intronic
933954113 2:87353143-87353165 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
934274881 2:91567347-91567369 CAGGTTCCAGGCCAGGGCCAGGG + Intergenic
934322427 2:91981900-91981922 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
934460733 2:94212723-94212745 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
936531331 2:113278627-113278649 CAGGCTTCCCGGGAGGATCAAGG + Intronic
937220987 2:120343348-120343370 CAGGCTCCCAGGCAGGGCAAGGG + Intergenic
943455548 2:188102979-188103001 GAGGCTGCACTGCAGGACAAGGG - Intergenic
944678175 2:202051957-202051979 CAGCCTCCACAGCAGTGCCAGGG + Intergenic
946028162 2:216684851-216684873 CTTGCTCCAGGGCAGGAGCATGG - Intronic
946310018 2:218878132-218878154 CAGGGCCCAGGGCAGGGCCAGGG + Intergenic
947623334 2:231604611-231604633 GAGGCTCCGAGGCGGGACCAAGG + Intergenic
947917076 2:233839593-233839615 CAGGCACCACAGAAGGAACAAGG + Intronic
948407993 2:237737075-237737097 AATCCTCCACAGCAGGACCAGGG - Intronic
948613440 2:239184254-239184276 CAGCCTCCAGGGCAGGTACAGGG - Intronic
948723468 2:239918129-239918151 CAGGCCCCAGAGCAGGTCCAAGG - Intronic
1169298996 20:4425825-4425847 AAGGGGCCAGGGCAGGACCAAGG + Intergenic
1169351982 20:4875614-4875636 ACCCCTCCACGGCAGGACCATGG + Intronic
1170518347 20:17155537-17155559 CAGGGTCCATGGCTGGTCCACGG + Intergenic
1170728934 20:18955558-18955580 CTGACTCCACCGCAGGATCACGG + Intergenic
1170830861 20:19839319-19839341 CAGGTTCCAGGGCATGCCCAAGG - Intergenic
1171238731 20:23548299-23548321 CAGGAGCCAGGACAGGACCAGGG + Intergenic
1171242873 20:23585939-23585961 CAGGGGCCAGGGCAGGACGAGGG - Intergenic
1171349336 20:24490803-24490825 CAGGCTCCAGGGCAGCACAGAGG + Intronic
1172299819 20:33841462-33841484 CAGGCTCACCTGCAGGACAAGGG - Intronic
1173846779 20:46193394-46193416 GAGGGTCCAGGGCAGGACCAGGG - Intronic
1174309018 20:49635942-49635964 CAGGCTCCACGGCAGGACCACGG + Exonic
1174489101 20:50879727-50879749 CAGGCCCCACGCTAGGAGCATGG + Intronic
1175540536 20:59745024-59745046 CAGGCTTAATGGCAGGATCACGG + Intronic
1175710444 20:61216406-61216428 GAGGCACCAGGGAAGGACCATGG - Intergenic
1175882728 20:62270188-62270210 CAGGCTCCTCGTCTGCACCAGGG - Intronic
1175901322 20:62360986-62361008 CAGTCTCCACGGCAACCCCAGGG - Intronic
1175904075 20:62371306-62371328 CAGGCACCATGCCAGGAGCATGG + Intergenic
1176591861 21:8655765-8655787 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
1176857772 21:13985558-13985580 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
1176857958 21:13986264-13986286 CAAGAAACACGGCAGGACCATGG - Intergenic
1176866843 21:14058706-14058728 CAGGGTCCAGGCCAGGGCCAGGG + Intergenic
1177555143 21:22679303-22679325 CAGGCCCCACGGCAGCATCTGGG - Intergenic
1180017727 21:45098182-45098204 CAGGCTCCACGGACCCACCAGGG + Intronic
1180167691 21:46038504-46038526 CAGGCCCCACGGCTGCACCCAGG + Intergenic
1180274702 22:10632866-10632888 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
1180950112 22:19717099-19717121 CAGGCCCCACAACAGGACCAGGG + Intronic
1181339412 22:22166121-22166143 AGGGCTCCAGGCCAGGACCAGGG - Intergenic
1181626733 22:24127260-24127282 CAGGCACCGCGGCTGGTCCAGGG - Intronic
1181627620 22:24132399-24132421 CCTGCTCCACAGCAGGTCCAAGG - Intronic
1182623484 22:31630368-31630390 CAGGCCCTCCGGCAGCACCAAGG + Intronic
1183546309 22:38456098-38456120 CAGGATCCAGGGCAGGAGCGGGG - Intergenic
1184193161 22:42908567-42908589 CAGGCTTCACGGCAGGGCATGGG - Intronic
1184684688 22:46090795-46090817 CAGGCCCCACAGCAGGGCAATGG - Intronic
1184814235 22:46858564-46858586 CAGGCGCCTCTGCAGGAACACGG - Intronic
1184919607 22:47596441-47596463 CAGGCCCCACAGCAGTGCCAGGG - Intergenic
1185071514 22:48659274-48659296 CTGGCTCCATGGCCAGACCATGG - Intronic
1185121734 22:48975373-48975395 CAGGCTCCACGTCTGTGCCAAGG + Intergenic
1185394355 22:50579127-50579149 GAGCCTCCAGGGCAGGACCTTGG - Exonic
950481576 3:13247512-13247534 CAGGCTCCACGCCAGAAGCTGGG + Intergenic
950500100 3:13358332-13358354 CAGGCTCCACCGCAGGAAAGGGG + Exonic
950958442 3:17079641-17079663 GGGGCTCCTCGGCAGCACCACGG - Intronic
951906916 3:27715166-27715188 CACGCTCCACGGGAAGACGAAGG - Intergenic
952006811 3:28850640-28850662 CACGCTTCACGGCATGAACAGGG - Intergenic
952326005 3:32321377-32321399 AAGGCTCCACGGAGGCACCAGGG - Intronic
952888994 3:38028981-38029003 AAGGCTGCACGGCCCGACCACGG + Intronic
953398446 3:42591123-42591145 CAGGCGCCGGGGCAGGACCCCGG + Intronic
956309078 3:67859211-67859233 CAGGCACACAGGCAGGACCAAGG + Intergenic
957085113 3:75670620-75670642 CAGCCTCCTCGCCAGCACCATGG + Intergenic
959072740 3:101717930-101717952 CAGGCTCCAAAGCTAGACCATGG - Intergenic
961220192 3:125193585-125193607 CAGGCTGAGGGGCAGGACCACGG + Intronic
965709512 3:171543215-171543237 CAGGCTGCAGGGCAGGAAAAAGG - Intergenic
967828367 3:193897273-193897295 CAGGAACCAAGGCAGGACCTAGG + Intergenic
967922531 3:194623619-194623641 CAGGCTCAGCGGCAGGGCCAGGG + Exonic
967925423 3:194641909-194641931 CAGTCTCCATGTCAAGACCAAGG - Exonic
968090881 3:195897468-195897490 GAGGCTTCAGGGCTGGACCATGG - Intronic
968433017 4:569974-569996 TAGGCCCCAAGGCAGGTCCATGG - Intergenic
968490955 4:890254-890276 GAGGCTCCAGGGCAGGGCCCAGG - Intronic
968645823 4:1740059-1740081 CAGGGTGCAGGGCAGGGCCAGGG - Intronic
969277192 4:6143925-6143947 CAGTCTCCAGGGCTGGAGCAGGG + Intronic
969354944 4:6619795-6619817 CAGGCACCAGGGGAGGACCTGGG + Intronic
969725096 4:8914011-8914033 CAGGCTCCCCTGCAGGCACAAGG - Intergenic
973972559 4:56228068-56228090 AAGGCTCCAAGGCAGGGACAGGG - Intronic
982064806 4:151644790-151644812 CAGGGTGCACAGCAGGAACAGGG - Intronic
983296395 4:165873777-165873799 GAGGCTCCTCGGCGGGACCGGGG - Exonic
983774929 4:171594878-171594900 CAGGCTCCCTGGCAGCAGCAGGG + Intergenic
983776055 4:171609115-171609137 CAGTCTCCAGTGCAAGACCAGGG + Intergenic
985445830 4:190020946-190020968 CAGCCTCCTCGCCAGCACCATGG - Intergenic
985626589 5:992026-992048 CAGGCTCCCAGGCAGCATCAGGG + Intergenic
987087876 5:14487094-14487116 CCGCCTCCACGGCAGCCCCAGGG + Intronic
996716898 5:126595333-126595355 CAGGCTCCTCCGGAAGACCAGGG - Exonic
997340840 5:133143470-133143492 CAGGCTATAGGGCAGGGCCAGGG - Intergenic
998040222 5:138946848-138946870 CAGGCTCCAGGGCAGGAACCTGG - Exonic
1002186825 5:177458519-177458541 CAGGCTCCACGGGAGCAGCCAGG + Exonic
1002427263 5:179183691-179183713 CAGGCTTCAGGGCAAGCCCAGGG + Intronic
1003508109 6:6756459-6756481 CAGTCTCCACCCCAAGACCAAGG - Intergenic
1005083581 6:21981300-21981322 CAGGTTCCAGGGCAGGAAGAAGG - Intergenic
1005322175 6:24666436-24666458 CCAGCTCCACGGCAGGTCCCAGG + Intronic
1006326748 6:33360077-33360099 CATGCCCCATGGCAGGCCCATGG - Intergenic
1006387434 6:33739166-33739188 CAGGCTGCACTGAAGGCCCAGGG - Exonic
1006472019 6:34235016-34235038 CAGGCTCCCCGCCAGCACCTTGG - Intergenic
1006647912 6:35527798-35527820 CAGGGTCCAGGGCATGGCCATGG - Intergenic
1006988628 6:38194141-38194163 CAGGCTCCCCTGCCGGCCCATGG - Intronic
1007072471 6:39047755-39047777 CATGCCCCACGGCAGGTCCGAGG + Intergenic
1013188946 6:107785658-107785680 CAGGCTCCACCACAGCACCCCGG - Intronic
1017083055 6:150686837-150686859 CACCCACCAAGGCAGGACCACGG + Intronic
1018626336 6:165782403-165782425 CAGAGTCCACAGCAGGGCCAAGG + Intronic
1018984852 6:168628791-168628813 CACGCTCAAAGGCAGGGCCAAGG - Intronic
1019285295 7:220221-220243 CAGGCTCTCAGGCAGGACCCAGG - Intronic
1019306539 7:337982-338004 CAGGCTCCTCCGCTGGTCCAGGG - Intergenic
1019494561 7:1331741-1331763 CTTGCTCCACGGGAGGCCCAGGG - Intergenic
1020099902 7:5388883-5388905 GAGGCTGCCCGGCAGGACGAGGG - Exonic
1021876000 7:25049868-25049890 CAGGATCAACGCCAGGACTAGGG + Intergenic
1022532302 7:31074636-31074658 CATGCTCCACGGCCGTTCCACGG + Intronic
1022905320 7:34849947-34849969 CTGGCTCCAAGCCAGGACCCTGG - Intronic
1025226223 7:57166586-57166608 CAGGCTCTTCAGCAGGAACATGG + Intergenic
1029280099 7:99429921-99429943 CAGGCTCTAAGGCAGAGCCATGG + Intronic
1029381800 7:100219984-100220006 CAGCACCCAGGGCAGGACCAGGG - Exonic
1029506321 7:100965956-100965978 GAGGCTCCACTGTAGGCCCAGGG - Intronic
1029600154 7:101558623-101558645 CAGGCTCCATGGCAGGCACCAGG + Exonic
1029724936 7:102396551-102396573 CAGGCTCCACGGCCCGTCCGAGG + Intronic
1032075465 7:128833841-128833863 CTGGCTCCACTGCAGCACAATGG - Intronic
1032076440 7:128838359-128838381 CAGGTTCCAGGCCAGGGCCACGG - Exonic
1033278225 7:139988534-139988556 CAGGGTTCTGGGCAGGACCACGG - Intronic
1035001054 7:155612302-155612324 CAGGCCTCATGGCAGGACCTCGG - Intronic
1035041229 7:155929010-155929032 CAGGCTCCTCTCCAGGTCCAAGG - Intergenic
1035133359 7:156675981-156676003 CAGCCTCCACGGCTGCACCCCGG - Intronic
1035212119 7:157336589-157336611 CCAGCTCCACCGCAGGACCGCGG + Intronic
1035305810 7:157930618-157930640 CAGGCACCACCTCAGGGCCAGGG - Intronic
1035569284 8:661307-661329 CAGGCTCCAGGGCAGAACTGTGG - Intronic
1035673656 8:1439373-1439395 CAGGGTACACGGCAGGACCGTGG - Intergenic
1035951975 8:4031855-4031877 CAGACTCCAGGGCAGGGCAATGG - Intronic
1036688295 8:10925886-10925908 CAGGCTCCAAGTCTGGGCCAGGG + Intronic
1038182210 8:25239995-25240017 CAGGGTGCACTGCAGGCCCAGGG + Intronic
1041090991 8:54300398-54300420 CAGACTCCACCGCAAAACCATGG - Intergenic
1041346525 8:56904447-56904469 CAGGCTCTATGGCTGGATCAAGG + Intergenic
1042445619 8:68882163-68882185 CAGGCTCCATGCCAGGCACAGGG + Intergenic
1044499325 8:92932962-92932984 CAGGTCCCAGGGCAGGAGCAGGG - Intronic
1048820398 8:138375053-138375075 CAGGCTCCAAGACAGGATCTAGG + Intronic
1048977457 8:139680884-139680906 CAGGCTGCTGGGCAGGACCATGG - Intronic
1049379274 8:142303936-142303958 CAGGCCCCTCGGCAGGGGCACGG + Intronic
1049431369 8:142566830-142566852 CAGGCTCTTCAGCAGGGCCAAGG - Intergenic
1049867227 8:144946885-144946907 CAGGCCCCACAGCAGGACACAGG - Intronic
1049867281 8:144947102-144947124 CAGGCCCCACAGCAGGACACAGG - Intronic
1049867316 8:144947249-144947271 CAGGCCCCACAGCAGGACACAGG - Intronic
1051555115 9:18374212-18374234 ACGGCTCCAAGGAAGGACCAGGG - Intergenic
1053691231 9:40588421-40588443 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
1054273570 9:63049064-63049086 CAGGTTCCAGGCCAGGGCCAGGG + Intergenic
1054302491 9:63389392-63389414 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
1054401264 9:64715892-64715914 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
1054434872 9:65200212-65200234 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
1054458610 9:65450023-65450045 CAAGCTCCACGGCAGGAAACAGG + Intergenic
1054495517 9:65821469-65821491 CAGGTTCCAGGCCAGGGCCAGGG + Intergenic
1056763075 9:89428336-89428358 CAGGTTCCCCTGCAGGGCCAGGG - Intronic
1059340538 9:113595139-113595161 CTGGCTCCAAGGCCAGACCAAGG - Intronic
1060509344 9:124220816-124220838 CAAGCTCCACGGCTGGAAAATGG - Intergenic
1060782476 9:126422957-126422979 CTGGCTCCACTGCAGGAGCCAGG + Intronic
1061389742 9:130310810-130310832 GAGGCTCCATGGCATGACCAAGG - Intronic
1061902719 9:133681151-133681173 CAGCCCCCGTGGCAGGACCAGGG - Intronic
1062472945 9:136714135-136714157 CAGGATCCACAGCAGGGTCAGGG + Intronic
1203621902 Un_KI270749v1:134584-134606 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
1190879338 X:54481846-54481868 AAGGCTCCACAGCAGGAAGAAGG + Intronic
1195471569 X:105236028-105236050 CAGGCTCCACTGCACCAGCATGG - Intronic
1195721671 X:107874494-107874516 CAGGCTGCTGGGCTGGACCAGGG + Intronic
1199671944 X:150155010-150155032 CAGGATGCACAGAAGGACCAGGG - Intergenic
1199696450 X:150345956-150345978 CAGACCCCAAGCCAGGACCATGG - Intergenic
1199852152 X:151732426-151732448 CAGGCTTCACCCTAGGACCAGGG + Intergenic
1200142786 X:153910142-153910164 CAGTCCCCTCGGCAGCACCAAGG + Intronic
1200179997 X:154144282-154144304 GAGGCTCCACTGCTGGGCCATGG - Exonic
1200185825 X:154182676-154182698 GAGGCTCCACTGCTGGGCCATGG - Intergenic
1200191477 X:154219814-154219836 GAGGCTCCACTGCTGGGCCATGG - Exonic
1200197232 X:154257618-154257640 GAGGCTCCACTGCTGGGCCATGG - Exonic
1201189914 Y:11437076-11437098 CAGGTTCCAGGCCAGGGCCAGGG - Intergenic
1202583716 Y:26404862-26404884 CAGGTTCCAGGCCAGGGCCAGGG + Intergenic