ID: 1174311667

View in Genome Browser
Species Human (GRCh38)
Location 20:49660625-49660647
Sequence CTGTGCAATGCTCATGTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174311662_1174311667 14 Left 1174311662 20:49660588-49660610 CCCTTAATCTTTTTAGAGATGCT 0: 1
1: 0
2: 2
3: 21
4: 349
Right 1174311667 20:49660625-49660647 CTGTGCAATGCTCATGTAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 106
1174311663_1174311667 13 Left 1174311663 20:49660589-49660611 CCTTAATCTTTTTAGAGATGCTA 0: 1
1: 0
2: 3
3: 18
4: 237
Right 1174311667 20:49660625-49660647 CTGTGCAATGCTCATGTAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 106
1174311661_1174311667 15 Left 1174311661 20:49660587-49660609 CCCCTTAATCTTTTTAGAGATGC 0: 1
1: 0
2: 1
3: 15
4: 256
Right 1174311667 20:49660625-49660647 CTGTGCAATGCTCATGTAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174311667 Original CRISPR CTGTGCAATGCTCATGTAGT TGG Intronic
902618888 1:17639087-17639109 CTGTGCACAGCTCCTGTGGTGGG - Intronic
904917500 1:33980908-33980930 ATGTGCAAAGGTCAGGTAGTGGG + Intronic
908659107 1:66418985-66419007 CTTTTCATTGCTCATGTAATAGG + Intergenic
911268823 1:95775821-95775843 CAATGCAATGCACATGAAGTAGG + Intergenic
916628158 1:166582265-166582287 AAGTGCAATGGTCATGAAGTGGG - Intergenic
920807066 1:209244902-209244924 TTGAGCAATTCTCATGTAGCAGG - Intergenic
922413641 1:225399472-225399494 CTGTGCAATGTCCCTGTGGTTGG + Intergenic
1064665521 10:17646731-17646753 CTGTGCAAGGCTTATGTACTGGG - Intronic
1064913345 10:20427588-20427610 GCTTGCAATGCTCATGTAGGTGG - Intergenic
1066311055 10:34197059-34197081 CTGAACATTGCTCGTGTAGTGGG - Intronic
1069524744 10:69159501-69159523 CTGTAAAATACTCATGTATTTGG + Intronic
1071589574 10:86860036-86860058 CTGTGGCATGCACCTGTAGTTGG + Intronic
1072905297 10:99447540-99447562 GTGTGCCATGCGCATGCAGTGGG + Intergenic
1075190116 10:120299543-120299565 CTGTGGTATGCCCATGGAGTAGG - Intergenic
1079236516 11:18694634-18694656 CTGTGCATTGCCCATGTCGCTGG + Intronic
1079881878 11:25938624-25938646 CTGTTCAATGCACATGCAATTGG + Intergenic
1080990319 11:37526297-37526319 CTGTGGAATACACATGTATTTGG - Intergenic
1084935851 11:72586285-72586307 CTGTGCAGTGGTTATATAGTTGG - Intronic
1085712205 11:78840400-78840422 CTAAGCAATGCTCATGTTCTCGG - Intronic
1086054070 11:82627283-82627305 CTTTTCATTGCTCATGTAATAGG - Intergenic
1093428729 12:19058861-19058883 CAGTGCAATGCTGATTTGGTGGG - Intergenic
1094739224 12:33269591-33269613 CTATGCAATGCTCATGCCGCTGG - Intergenic
1099020602 12:77399395-77399417 GTGTCCAGTGGTCATGTAGTTGG + Intergenic
1100448012 12:94678880-94678902 CAGTGCAATTCTTATTTAGTGGG + Intergenic
1105763223 13:23532220-23532242 CTGTGCCTTGCTAATCTAGTGGG + Intergenic
1108590365 13:51907431-51907453 CTGTGGAAGGCTGATGAAGTAGG - Intergenic
1114255434 14:20997710-20997732 CTGTCCCATGCTCATGTTGATGG + Intergenic
1123955409 15:25329368-25329390 CTGTGAAATGAGCATGAAGTGGG + Intergenic
1126070865 15:44863817-44863839 CTTTTCATTGCTCATGTAATAGG + Intergenic
1126384362 15:48078564-48078586 TTGTGCAATACTCATGTGGCTGG - Intergenic
1129929136 15:79394560-79394582 CTGTGAAATGCCCATGAAATGGG + Intronic
1130022470 15:80242795-80242817 CTTTACACTGCTCATGGAGTTGG + Intergenic
1130973340 15:88752871-88752893 CTCTTCAATGCTTTTGTAGTTGG - Intergenic
1131738227 15:95357517-95357539 CTGTGGAATGCTCATTCAATGGG + Intergenic
1134561055 16:15209990-15210012 CACTGCAAGGCTCATGTAATGGG - Intergenic
1134921592 16:18121614-18121636 CACTGCAAGGCTCATGTAATGGG - Intergenic
1137241961 16:46663358-46663380 CTTTGCAATGTTAATGTATTTGG + Intronic
1139538999 16:67599764-67599786 CTTTGCCAAGCTCATTTAGTTGG + Intronic
1143769913 17:9162042-9162064 CTGAGCAATGCTCATGGGGAGGG + Intronic
1145212821 17:21027608-21027630 CCTTGGAATGCTCATGGAGTTGG - Intronic
1147560339 17:41505068-41505090 CTCTTCAATGGTCTTGTAGTAGG + Exonic
1148495306 17:48049942-48049964 CTGGGTAATGCGCCTGTAGTGGG + Intronic
1150148043 17:62786800-62786822 ATGTGCAATACTCATGCATTTGG - Intronic
1152097430 17:78280106-78280128 CTGTGCAGGGGCCATGTAGTGGG + Intergenic
1157590773 18:48835414-48835436 CTGTGTAAGGCTCATGTACTTGG + Intronic
1159161971 18:64654305-64654327 CTGTGAAATTTTCAGGTAGTAGG + Intergenic
1159898365 18:74019025-74019047 CTGAGCAATGGCCATGTAGAAGG + Intergenic
1160085796 18:75776589-75776611 CTGTGCAATGTTCACTAAGTAGG + Intergenic
1168415443 19:56164777-56164799 CTGTGCAAAAGTCCTGTAGTGGG - Intergenic
927569415 2:24145071-24145093 CTGGGCACTGGTCATGTTGTGGG - Intronic
928734686 2:34274008-34274030 ATTTGCAATGCTTCTGTAGTTGG + Intergenic
937729332 2:125208604-125208626 CTTTGCCATGATCATTTAGTTGG + Intergenic
937879659 2:126856026-126856048 CTGTGCCATGCTCATCTATTGGG - Intergenic
940516004 2:154684618-154684640 CTCTGCAGTTCACATGTAGTGGG - Intergenic
941962492 2:171267640-171267662 GTGTGCAATGCACATGCATTTGG - Intergenic
946311815 2:218886324-218886346 CTGTGCATTGCTCATGTGCCTGG - Intronic
946536339 2:220633742-220633764 CTGAAAAATGCTCAGGTAGTGGG + Intergenic
1169005229 20:2201102-2201124 CTGTGAAATGCTCAGGTAACTGG + Intergenic
1171176627 20:23055136-23055158 CTGTTCACTGCCCAGGTAGTTGG - Intergenic
1174311667 20:49660625-49660647 CTGTGCAATGCTCATGTAGTTGG + Intronic
1178367915 21:32002862-32002884 CTGTGCAAAGCCCCAGTAGTCGG + Exonic
1179067133 21:38036032-38036054 TTGTAAAATGCTCATGTTGTGGG + Intronic
1179190524 21:39118657-39118679 CTGAGCAATGCAAATGTAATGGG - Intergenic
1179358083 21:40680934-40680956 CTGTCCAAGGCTCATGTATGGGG - Intronic
1180068728 21:45425526-45425548 CTGTGCAGTGTTCATGCAGGAGG - Intronic
1182062011 22:27405128-27405150 CTGCGCAAAGGTCCTGTAGTAGG - Intergenic
952953212 3:38541013-38541035 CTGTGGTATGCTCATATAATGGG + Intronic
953558583 3:43966744-43966766 GTGTGAAATGCACATGTATTCGG - Intergenic
956168252 3:66412645-66412667 CTGTGCACTGGGCATGGAGTGGG - Intronic
957966721 3:87331290-87331312 AAGTGCAATGATAATGTAGTTGG + Intergenic
962023109 3:131520670-131520692 CTCTGCAATGCTCCTGGACTGGG - Intergenic
966287619 3:178315980-178316002 CTGTGAGAGGCTCATGTGGTGGG + Intergenic
971963489 4:33520045-33520067 CACTGCAATGCTCAGGAAGTAGG + Intergenic
973893787 4:55393015-55393037 CAATGTAATGCACATGTAGTAGG + Intergenic
975498461 4:75058823-75058845 CTGAGCAATGCTCAGGCAGAAGG + Intergenic
977977395 4:103282350-103282372 CTGTAGAAAACTCATGTAGTTGG - Intergenic
979647011 4:123081354-123081376 CTATGCAGTGTTCCTGTAGTTGG + Intronic
982228369 4:153186156-153186178 CTGGGCACTGCTGATGTTGTGGG - Intronic
982487526 4:155984953-155984975 CTGTTGAATGGTCATGAAGTTGG - Intergenic
993321351 5:86471566-86471588 TTGGGAAATGCTGATGTAGTTGG - Intergenic
994023560 5:95055592-95055614 CTGTGAAATGCACTTTTAGTTGG - Intronic
996105086 5:119491916-119491938 CTTTGCACTGCTCATGTTATCGG - Intronic
999460323 5:151752159-151752181 CTGAGCAATGCTGATCTGGTGGG + Intronic
1004532024 6:16462659-16462681 CTTTTCATTGCTCATGTAATAGG - Intronic
1004571437 6:16849688-16849710 CAGTGAAATGCTCATTTAGTTGG - Intergenic
1012520443 6:100115079-100115101 CTGTGGAAGGCCCATGCAGTGGG - Intergenic
1016911190 6:149200808-149200830 CTCTGCATTTCTCATTTAGTTGG + Intergenic
1020609675 7:10379043-10379065 GTGTACACTGCTCATGTGGTGGG + Intergenic
1021828266 7:24574918-24574940 CTGTGCAATGATAGGGTAGTGGG + Intronic
1022242609 7:28527571-28527593 CTGTGAGAGGCTCATGTAGGAGG + Intronic
1024687483 7:51762415-51762437 CTGTGCAATGTACATGTAGCAGG + Intergenic
1025205644 7:56992079-56992101 CTGAGCCATGCTCCTGTGGTCGG + Intergenic
1025666296 7:63584859-63584881 CTGAGCCATGCTCCTGTGGTCGG - Intergenic
1026322022 7:69276569-69276591 CTGTGCTATGCTGGTTTAGTGGG - Intergenic
1026950774 7:74345112-74345134 ATGTGCCAGGCACATGTAGTTGG + Intronic
1028237397 7:88378899-88378921 GTGTGCACTGCTCAGGTGGTGGG - Intergenic
1031215576 7:118886174-118886196 CTGTTCAATTTTCATGTATTTGG - Intergenic
1034200169 7:149279238-149279260 CTGGGCTCTGCTCATGGAGTTGG + Intronic
1038893169 8:31750727-31750749 TTAGGCAATGCTCATTTAGTAGG - Intronic
1041431253 8:57783016-57783038 ATATGCAATCCTTATGTAGTGGG - Intergenic
1042373068 8:68014813-68014835 CTATGCGATTCTGATGTAGTTGG - Intronic
1044592139 8:93923629-93923651 CAGTTCAATTCTCATGTTGTAGG + Exonic
1045976705 8:108137843-108137865 CTGTGCAAGGCTGCTGTAATGGG + Intergenic
1055736534 9:79336637-79336659 CTGTGCAGAGATCATGTAGCAGG - Intergenic
1057114352 9:92506553-92506575 CGGTGCAATGCCCATGAAGGGGG - Intronic
1057690823 9:97283069-97283091 CTGTTCAGTGCTCATGTAAAAGG - Intergenic
1058238464 9:102524023-102524045 GTGTGCACTGCTCAGGAAGTGGG - Intergenic
1059746453 9:117206366-117206388 CTGTGGAATTCTCCTGTAGTAGG - Intronic
1186564685 X:10650300-10650322 CTGTCCAATCCTTATGTAGATGG - Intronic
1187451069 X:19396864-19396886 CATTGCAATGCTCATTTTGTTGG + Intronic
1188164538 X:26845773-26845795 CTGTGGAATGCTCTTATGGTAGG - Intergenic
1188663568 X:32790863-32790885 TTGTGCAATGCTCAGGTGGAAGG - Intronic
1190741907 X:53294446-53294468 CTGTCCAATGTTCATGAAGCTGG + Intronic