ID: 1174314699

View in Genome Browser
Species Human (GRCh38)
Location 20:49689395-49689417
Sequence CTGTGAAATTGTAGTTCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174314699 Original CRISPR CTGTGAAATTGTAGTTCCCA CGG (reversed) Intronic
901942718 1:12676012-12676034 CTGTGATATTGTATTACTCAGGG + Intergenic
902491106 1:16781300-16781322 CTCTGAGATTTTATTTCCCAGGG - Intronic
903333425 1:22609203-22609225 CTGTGAAGTGGTAGAACCCAAGG + Intergenic
903507615 1:23849409-23849431 CTGTGACACTGTACTTCTCATGG + Intronic
904039118 1:27574266-27574288 CTGTGAGATTTCACTTCCCAAGG - Intronic
904754783 1:32762274-32762296 CTGTGAATTTTTAGTTCCCTAGG + Intronic
905094776 1:35460303-35460325 ACCTGAAAGTGTAGTTCCCAGGG + Exonic
905226698 1:36483287-36483309 CTGTGAAGATGTGGTCCCCAAGG - Intergenic
908912243 1:69085512-69085534 CTGTGAAACTTTTGTTTCCAAGG - Intergenic
909005497 1:70271369-70271391 TTATGAAATTGTAGTTCAGAAGG - Intronic
909688026 1:78372669-78372691 TTGTCAAATTGTAATTCCCAGGG - Intronic
911451906 1:98073281-98073303 CTGTGATGTTGCAGTTGCCATGG + Intergenic
912023346 1:105136746-105136768 CTGTGATATTGAAGTCTCCATGG - Intergenic
914459600 1:147870973-147870995 AAGTAAAATTGTAGTTGCCAGGG + Intergenic
915854246 1:159364143-159364165 CTGAGAAATTTTAGTTCCTTAGG - Intergenic
920430074 1:205913155-205913177 CTGTGATAATATAATTCCCAGGG - Exonic
921507068 1:215984584-215984606 ATGTCAAATTGTATTTCCTAAGG + Intronic
921754247 1:218835084-218835106 ATGAGAAATTGGAGTTCTCAGGG - Intergenic
923529337 1:234801234-234801256 CTCTGAGATTTTATTTCCCAGGG + Intergenic
1063392617 10:5660164-5660186 CTGTGAAACTCTAGTTTTCAGGG - Intronic
1064724703 10:18266928-18266950 CTGTGCAAATATATTTCCCAAGG - Intronic
1064909548 10:20385045-20385067 CTGTTGAAATGTAGTCCCCAAGG + Intergenic
1067113486 10:43417368-43417390 CTGTGAAAGTGTAGAGCCCCCGG - Intergenic
1067950357 10:50730240-50730262 CTATGAAATTGTGTTTCCAATGG + Intergenic
1068172205 10:53408670-53408692 CTTTAAAATTGTAGTCACCAGGG + Intergenic
1068273814 10:54765851-54765873 CTATGAAATTGTGTTTCCAATGG - Intronic
1068615673 10:59113010-59113032 ATGTGTAATTGATGTTCCCAAGG - Intergenic
1069401078 10:68047652-68047674 GTTTTAAATTGTAATTCCCATGG - Intronic
1070885692 10:79895461-79895483 CTATGAAATTGTGTTTCCAATGG + Intergenic
1071142832 10:82531954-82531976 TTGTGAAATAGTGGTTTCCAGGG - Intronic
1071431362 10:85609556-85609578 CTGTGAAAGATTAGATCCCAGGG - Intronic
1073974320 10:109083867-109083889 ATGTTAAATTGTAATTCACATGG + Intergenic
1074191511 10:111142041-111142063 CTTGGAAATTGTGGTTCCTAGGG + Intergenic
1079838260 11:25363085-25363107 ATGTTGAATTGTAATTCCCAAGG - Intergenic
1080109375 11:28548139-28548161 CTTTGAAATGGTATTTCCGAGGG + Intergenic
1082878539 11:58014283-58014305 ATGTCAAATTGTAATCCCCAAGG - Intergenic
1084617699 11:70247387-70247409 GTGTCAAATTGTAATCCCCATGG - Intergenic
1085214563 11:74817547-74817569 CTGTCCATTTGGAGTTCCCAAGG - Intronic
1085382273 11:76130877-76130899 CTGTGAGATTGTTGTTCCTCTGG + Intronic
1086960109 11:92972670-92972692 CTGTCAGATTGTGCTTCCCAGGG + Intronic
1087429396 11:98033271-98033293 CAGTGAAATTCTAGTTGCCTAGG + Intergenic
1087814298 11:102641478-102641500 CTGAGAAATTGGAGTCCACAGGG + Intergenic
1092905660 12:13098541-13098563 CCGTGGAGTTGTATTTCCCATGG - Intronic
1095628261 12:44343532-44343554 AAGTGAAATGGTAGTTGCCAGGG + Intronic
1098945192 12:76581899-76581921 GAGTGAAATGGTAGTTTCCAAGG + Intergenic
1099341750 12:81445600-81445622 CAGTGAAGTTGAAGTTCTCAAGG - Exonic
1100887973 12:99093441-99093463 CTGGGAAAATGAAGTTCTCAGGG + Intronic
1103168575 12:118792883-118792905 CAGTAAAATGGTGGTTCCCAGGG - Intergenic
1105632679 13:22186569-22186591 CTTTATAATTGTAGTCCCCAAGG + Intergenic
1105972381 13:25441385-25441407 CTGTGACATTGTTGTTCCAATGG - Intronic
1108437660 13:50416752-50416774 TTCTGGAATTGTACTTCCCAGGG - Intronic
1108441197 13:50454564-50454586 CTTTGAAAATGTAGATCCCTAGG + Intronic
1112168521 13:96945873-96945895 CGTTTAAATTTTAGTTCCCATGG + Intergenic
1115256767 14:31411374-31411396 CTGTGCATTTGTAGTTTTCATGG - Intronic
1115352946 14:32415707-32415729 CAGTAAAATTGTGGTTTCCAGGG - Intronic
1116681969 14:47983813-47983835 CTGTGAAATTATAGTTGCTTTGG - Intergenic
1116966918 14:51024667-51024689 ATCTGAAATTATAGTTGCCAGGG + Intronic
1117222982 14:53625048-53625070 ATGTGAAATTTTAGAACCCAGGG - Intergenic
1119128544 14:72150818-72150840 ATGTCAAATTGTAATCCCCAAGG - Intronic
1120004500 14:79341622-79341644 CTCTGAATTTGGAGTTCACATGG - Intronic
1120754028 14:88225038-88225060 TTGTGAATTTTTAGTTCTCATGG - Intronic
1121384667 14:93509238-93509260 ATGTTGAATTGTAATTCCCATGG - Intronic
1121795838 14:96734668-96734690 CGGTGAATTTGTAGAGCCCAAGG - Intergenic
1123213756 14:106786525-106786547 ATGTCAAATTGTAATTCCCAGGG - Intergenic
1126368836 15:47924510-47924532 GTGTGAAATTGTCTGTCCCAGGG - Intergenic
1128299477 15:66556764-66556786 CTGTGGAATCGTGGTTGCCAGGG + Intronic
1128789646 15:70423668-70423690 CCTGGAAAATGTAGTTCCCAGGG - Intergenic
1128902213 15:71434617-71434639 CTGTGAAGTTTTAGTTACCAGGG + Intronic
1131004259 15:88963793-88963815 ATGTCAAATTGTAATCCCCATGG + Intergenic
1138236308 16:55386035-55386057 CTGTGATATTATAGCTCACAGGG + Intergenic
1138711186 16:58971950-58971972 ATGTCAAATAGTAGTCCCCAAGG - Intergenic
1139424347 16:66869953-66869975 GTTTGAAACTGTATTTCCCATGG + Intronic
1141216166 16:82025833-82025855 CTGTGAGAAGGTAGTTCCCTAGG + Intergenic
1143773161 17:9181120-9181142 CTGGGAAATGAGAGTTCCCAAGG - Intronic
1148328398 17:46797521-46797543 CTTTGAGATTGTTTTTCCCATGG - Intronic
1148803406 17:50248726-50248748 CTGTGAGATTGTATTTTCTATGG + Intergenic
1150161744 17:62904281-62904303 CTTTCAATTTGTAGTTCCGAGGG - Intergenic
1151642213 17:75404760-75404782 CTGTGAAAGTGCAGTTTGCAGGG - Intronic
1154072980 18:11171218-11171240 ATGTAAATTAGTAGTTCCCAGGG + Intergenic
1155436743 18:25820292-25820314 CTGTGAAATTGTAGGTGGCAGGG - Intergenic
1157069358 18:44387818-44387840 CTCTGAAATTATAATACCCATGG + Intergenic
1158407365 18:57171997-57172019 CTGTGAAATTATAGGTCAAAGGG - Intergenic
1158789564 18:60761378-60761400 ATCTTGAATTGTAGTTCCCATGG + Intergenic
1159132620 18:64296869-64296891 GTGTGGAATGGTAGTTGCCAAGG - Intergenic
1160176982 18:76602783-76602805 CTGTGAAAATGTCGTCCCTAGGG + Intergenic
1161909601 19:7183122-7183144 GTGGGAAATTGTATTTCCCTGGG - Intronic
1162330689 19:10027489-10027511 CTGTGAAATGGAACTTGCCAGGG + Intergenic
1162407815 19:10486246-10486268 CTCTGGAAATGTGGTTCCCAGGG - Exonic
1164155136 19:22590486-22590508 TTCTGAAATTGTAGTTCTCTGGG + Intergenic
926370968 2:12178355-12178377 CTGTGTAGTTGTGGTTTCCAAGG + Intergenic
929750265 2:44704543-44704565 CTGTGCAATATTAGTACCCAAGG - Intronic
930456833 2:51616214-51616236 CTGTGAAAGAGAACTTCCCAAGG + Intergenic
932758729 2:74426066-74426088 CTCTTAAATTGTGGTTGCCATGG - Exonic
934794050 2:97085656-97085678 CTGTGCAATGGTAGGTACCAGGG + Intronic
936727981 2:115345704-115345726 CTGTGATATTGAAGCTCCGAAGG + Intronic
937591950 2:123624947-123624969 CTGTGAGATGGCAGTTCCCATGG + Intergenic
937787361 2:125917503-125917525 CTGTGAAATTGTTGTCCACATGG + Intergenic
938612820 2:132966566-132966588 ATGTGAAATTATTGTTCCTAGGG + Intronic
939528841 2:143331188-143331210 TTGCTAAAATGTAGTTCCCAGGG - Intronic
939972173 2:148674785-148674807 CTGAGAAATTGCAGTACCCCAGG - Intronic
940114056 2:150188447-150188469 CTGTGGAATTTTTGTTCCCTAGG - Intergenic
940537854 2:154969206-154969228 TTGTGAACTTCTAGTTCCTATGG - Intergenic
941104063 2:161332541-161332563 CTGTGAAATTGTTGATCAGATGG + Intronic
947015804 2:225618409-225618431 CTGTGTTATTGTAATTGCCAAGG + Intronic
947488595 2:230574820-230574842 ATGTGGAATTGTAATCCCCAAGG - Intergenic
948011543 2:234652938-234652960 CCCTGAAATTGGAGGTCCCATGG - Intergenic
948763247 2:240205451-240205473 CTGTGAAAGTGTTGCTCACAGGG - Intergenic
1169777311 20:9269864-9269886 CTGTCAAATTGTGATTGCCAGGG + Intronic
1174314699 20:49689395-49689417 CTGTGAAATTGTAGTTCCCACGG - Intronic
1176297159 21:5080225-5080247 CTGAGAATGTGAAGTTCCCAAGG - Intergenic
1177453853 21:21308717-21308739 ATGTGAAATTGGAGTCCCAAAGG - Intronic
1178413682 21:32386788-32386810 CTGTGAAATACTAGTACCTAGGG - Intronic
1179859869 21:44181722-44181744 CTGAGAATGTGAAGTTCCCAAGG + Intergenic
1184153134 22:42649735-42649757 CTTTGAATTTGTAGTTCCCTGGG + Intergenic
951184588 3:19698055-19698077 CTGTGGAATAGTGGTTTCCAGGG + Intergenic
951186351 3:19718102-19718124 CTGTGAGATTGTAGAACCCTTGG + Intergenic
953361617 3:42302074-42302096 ATGCCAAATTGTAATTCCCAGGG + Intergenic
954829980 3:53412377-53412399 CTGTGAAATCTCTGTTCCCAGGG + Intergenic
956014588 3:64868226-64868248 CTTTGAAAGTGAAGATCCCATGG + Intergenic
957174409 3:76787158-76787180 ATGTTGAATTGTAATTCCCAGGG - Intronic
957868253 3:86051901-86051923 ATGTCAAATTGTAATTCCCAGGG - Intronic
958669375 3:97183116-97183138 CTGTGCAATTGTAATTCATAAGG + Intronic
958976985 3:100679498-100679520 CTGTTAAATTTGTGTTCCCATGG + Intronic
959686332 3:109151509-109151531 ATGTTAAATTGTAATTCCCATGG + Intergenic
960386141 3:117023948-117023970 CTGTTTAACTGTGGTTCCCATGG + Intronic
960707932 3:120499145-120499167 CTGTGAAATTGCAGTGGACAGGG - Intergenic
960997714 3:123350814-123350836 CTGTAAAATGGTAATTCCCCTGG + Intronic
962451194 3:135518631-135518653 CTTTGAAACTGTTGTTCTCAAGG - Intergenic
962923291 3:139970024-139970046 ATGACAAATTGAAGTTCCCATGG - Intronic
963084922 3:141427784-141427806 CTGTGATAATGCAGTCCCCAGGG - Intronic
963553571 3:146756942-146756964 CTCTGATATTGTAGATTCCAAGG + Intergenic
963840484 3:150099958-150099980 CAGTAAAATGGTAGTTACCAGGG - Intergenic
964975097 3:162609012-162609034 CTGTTAAATTGAAGTTCTAACGG - Intergenic
965381596 3:167996145-167996167 CTGTAAAATAGTATTTCCCTGGG - Intergenic
966260411 3:177971200-177971222 ATGTGAAATGGTAGCTCCCATGG - Intergenic
969326905 4:6449360-6449382 CTGTGAAAGTGCAGTTCTCTCGG - Intronic
970453928 4:16202698-16202720 CTGTTAATTTGTTATTCCCAGGG - Intronic
971024655 4:22576822-22576844 AAGTGAAATGGTAGTTGCCAGGG + Intergenic
971856917 4:32055504-32055526 CTGTTTAATTGTAATTCTCAAGG - Intergenic
972175198 4:36396224-36396246 CTTTGAAAATGTAATTCCTAAGG + Intergenic
972765196 4:42146353-42146375 CTGTGAAGGTGTATTTGCCAAGG + Intronic
972844560 4:42971698-42971720 ATCTCAAATTGTAATTCCCATGG - Intronic
973960444 4:56104587-56104609 CTGGGAACGTGCAGTTCCCAAGG - Intergenic
974463959 4:62229497-62229519 CTGTGGAACTGTATTTCCAAAGG + Intergenic
975959016 4:79878147-79878169 GTGTTAAATTGTAATCCCCAGGG + Intergenic
976255378 4:83095047-83095069 TTTTGAAATTCTACTTCCCAAGG - Intronic
977960783 4:103082761-103082783 AAGTGAAATGGTAGTTGCCAGGG - Intronic
980145367 4:128976891-128976913 CATTGACATTGTAGTCCCCATGG - Intronic
980701301 4:136434824-136434846 CTGTGAAATGTTAGTTCTCTGGG + Intergenic
981249197 4:142578913-142578935 CTCTTAAATTTAAGTTCCCAGGG + Intronic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
984748081 4:183242640-183242662 CTGTGAAAATTTGGTTCTCAAGG + Intronic
985047362 4:185953505-185953527 GTGTTAAAGTGTACTTCCCAAGG + Intronic
986457739 5:7937200-7937222 GTGTCAAATTGTAATCCCCAAGG + Intergenic
987827097 5:23046179-23046201 ATGTCAAATTGTAATCCCCAGGG + Intergenic
988237533 5:28564669-28564691 ATCTCAAATTGTAATTCCCAGGG + Intergenic
989104963 5:37853962-37853984 ATGGCAAATTGCAGTTCCCATGG - Intergenic
990392749 5:55343690-55343712 TTTTAAAATTGGAGTTCCCAAGG - Intronic
993788801 5:92179942-92179964 CTGTGAAATTTTTATTCCTAAGG + Intergenic
1001480657 5:172086945-172086967 CTGGGCAATTGAAGTTCTCAGGG - Intronic
1002776760 6:334628-334650 CAGTGAAATTGTAGCTGTCATGG + Intronic
1005153014 6:22774362-22774384 CTGTGAAATTGTATGCACCAAGG - Intergenic
1007889073 6:45269451-45269473 CTCTCAAATTGTAGTTGTCATGG - Intronic
1008860223 6:56140034-56140056 CTGTAAAATTGAATTTGCCATGG + Intronic
1009315664 6:62216557-62216579 CTGTGAAAGTGAAGTTCCACAGG + Intronic
1009641664 6:66345345-66345367 CTGTGATTCTGTAGTTCCCATGG + Intergenic
1009870413 6:69446154-69446176 CATTCAAATTTTAGTTCCCATGG + Intergenic
1010004679 6:70982688-70982710 CTGTGAATTTTTAGTTACCTCGG - Intergenic
1010285989 6:74078657-74078679 CTCTAAAATTGCATTTCCCAGGG + Intergenic
1011151488 6:84278519-84278541 CTGTGGAAATGTACTTCACAGGG - Intergenic
1012039601 6:94186815-94186837 ATGTCAAACTGTAGTCCCCAAGG - Intergenic
1013419331 6:109951771-109951793 ATGTTGAATTGTAATTCCCAGGG + Intergenic
1013969262 6:115997356-115997378 CAGTGAACTTGGAGTTCCCATGG - Intronic
1014181982 6:118394728-118394750 CTGTGGAATTGTTGCTCACAGGG - Intergenic
1014483106 6:121962989-121963011 CTCTAAAATTGCATTTCCCAGGG + Intergenic
1014678595 6:124399498-124399520 TTGTGAAATTCAAGTTTCCATGG + Intronic
1015153571 6:130065025-130065047 CTGAGAGATTGTATTTCCCAGGG + Intronic
1018643130 6:165923276-165923298 CTTTGAAAGTCTATTTCCCAGGG - Intronic
1020250344 7:6463167-6463189 CTTTGAAATTCTAGTACTCAAGG - Exonic
1020424969 7:8054969-8054991 CTTTAAAATTGTAAATCCCATGG - Intronic
1022993243 7:35728881-35728903 CCTGGAAAATGTAGTTCCCAAGG + Intergenic
1026340874 7:69432900-69432922 GTTTGAAAGTGCAGTTCCCAGGG + Intergenic
1028252915 7:88557185-88557207 CTGTTAAATTATAGGACCCAAGG + Intergenic
1029727207 7:102414926-102414948 CTGTGATATAGTAATTCCCATGG - Intronic
1030237772 7:107285432-107285454 GTTTGACATTGTAGTTACCAAGG - Intronic
1034173510 7:149082072-149082094 CTGTTGAATTGTAATCCCCAGGG + Intronic
1034477685 7:151296240-151296262 ATGTCAAATTGTAATCCCCAAGG - Intergenic
1036440416 8:8777009-8777031 ATGTCAAATTGTAGTACCCAAGG + Intergenic
1036945823 8:13094050-13094072 CTGTGAAATTTTAAATCCAACGG + Intronic
1037714089 8:21382251-21382273 CTGTAAAGTTGTAGTTTACATGG - Intergenic
1039155526 8:34552494-34552516 CTGTAGAATTGTCGTTTCCATGG + Intergenic
1039975977 8:42365202-42365224 CTGTGAAAGTGTATTTTCTAAGG + Intronic
1042460908 8:69067218-69067240 CTGTGAAATTGCTGTCTCCAAGG + Intergenic
1043163754 8:76877495-76877517 CTGAGAAATTGTATTTTACAAGG - Intergenic
1043824187 8:84905109-84905131 GAGTGAAATGGTAGTTACCAGGG - Intronic
1045796867 8:106056468-106056490 CTGTTAAATTTAAGTCCCCAAGG - Intergenic
1046107745 8:109686663-109686685 CTGTGAGAATGTTCTTCCCAAGG - Intronic
1046634992 8:116664562-116664584 GTGAGAAATTGTATTTCACAAGG - Intronic
1047336581 8:123942147-123942169 CAGTTAAATAGTAGCTCCCAAGG - Intronic
1049726710 8:144149886-144149908 CTGTGGGATTGCATTTCCCAGGG + Intronic
1051822683 9:21186173-21186195 ATGTGAATTTGCAGTTTCCAAGG - Intergenic
1051824576 9:21205749-21205771 ATGTGAATTTGCAGTTTCCAAGG - Intergenic
1051826513 9:21226812-21226834 ATGTGAATTTGCAGTTTCCAAGG - Intronic
1052983316 9:34465119-34465141 CTCTGAAATTGTCCTTTCCAAGG - Intronic
1053455871 9:38232847-38232869 GTGAGAATTTGGAGTTCCCAGGG - Intergenic
1053590787 9:39512626-39512648 TTGTGAAAGTGAAATTCCCATGG + Intergenic
1053848639 9:42267987-42268009 TTGTGAAAGTGAAATTCCCATGG + Intergenic
1054575517 9:66852663-66852685 TTGTGAAAGTGAAATTCCCATGG - Intergenic
1054739660 9:68792105-68792127 CTGTGATCCTGTTGTTCCCAGGG + Intronic
1054970704 9:71082544-71082566 CTGTTAAATGATAGTTCACAAGG + Intronic
1057149334 9:92782503-92782525 CAGTGACATTTTAGTTCCCCTGG - Intergenic
1062369606 9:136231048-136231070 CTGTGTAAATTTACTTCCCATGG - Intronic
1188031298 X:25267380-25267402 ATGTGAAAGTGTGGTTCCTAGGG + Intergenic
1188452240 X:30319869-30319891 CTGTGTTTTTGTACTTCCCAGGG - Intergenic
1190110806 X:47587808-47587830 GTCTGAAATTCTAGTTCCCAAGG - Intronic
1190468490 X:50751246-50751268 CTGTGAAATTATTGCTCCTAGGG + Intronic
1190547869 X:51548477-51548499 ATGTCAAATTGTAATACCCATGG + Intergenic
1192786512 X:74341195-74341217 ATGTGATATTTTAGTTCACATGG - Intergenic
1193067569 X:77275690-77275712 CAGTGAAATTGTGTTTCCCTGGG + Intergenic
1193319315 X:80102285-80102307 CAGTGTAATTGCTGTTCCCATGG - Intergenic
1194893126 X:99405558-99405580 ATATTAAATTGTAATTCCCACGG + Intergenic
1194945667 X:100064030-100064052 ATGTGACTCTGTAGTTCCCAAGG + Intergenic
1196037052 X:111157136-111157158 CTGTTAAATTGCAGATTCCAGGG + Intronic
1196702973 X:118691815-118691837 CTGTGAAATTGGATTACGCAAGG - Intergenic
1198679822 X:139169699-139169721 TAGGGACATTGTAGTTCCCAAGG - Intronic
1199530919 X:148846743-148846765 AGGTGAAATTGTAGTTCTCAGGG + Intronic