ID: 1174315282

View in Genome Browser
Species Human (GRCh38)
Location 20:49695144-49695166
Sequence GATTATGAAAAATTGGAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174315282_1174315285 3 Left 1174315282 20:49695144-49695166 CCTAACTCCAATTTTTCATAATC 0: 1
1: 0
2: 0
3: 31
4: 269
Right 1174315285 20:49695170-49695192 ATGGCTTTTATTGAACAATCTGG 0: 1
1: 0
2: 2
3: 29
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174315282 Original CRISPR GATTATGAAAAATTGGAGTT AGG (reversed) Intronic
900491461 1:2951338-2951360 GATTTTGAAAACTTGGAGCCTGG + Intergenic
906437927 1:45812723-45812745 GACTATTAAAAATAGGAGTAGGG - Intronic
907811662 1:57876946-57876968 GATTATGAAAAGTTGCAGTGAGG + Intronic
909228619 1:73058229-73058251 GATTGTGAGAAATTGCAATTTGG - Intergenic
910389743 1:86728059-86728081 GAATAGGAAAATTTGGGGTTAGG + Intronic
911747260 1:101453527-101453549 AATTGTGAAAATTTGGACTTGGG + Intergenic
912828499 1:112928722-112928744 GATTTTTAAAAATTGATGTTGGG - Intronic
913185493 1:116367112-116367134 TATGATGAAAAACTGGAATTAGG - Intergenic
913393882 1:118345022-118345044 GATTATGTAAAACTTAAGTTTGG - Intergenic
916290107 1:163156411-163156433 GATGAGGCAACATTGGAGTTGGG - Intronic
917026916 1:170654341-170654363 GAGGAAGAGAAATTGGAGTTTGG - Intergenic
918811125 1:189122543-189122565 GATTGTGGAAAATTCGGGTTTGG - Intergenic
919196461 1:194293310-194293332 AATTATGTAAAACTTGAGTTGGG + Intergenic
919321117 1:196039708-196039730 AATTTTTAAAAATTAGAGTTAGG - Intergenic
920456146 1:206102932-206102954 AACTATGAAAAATTGGAGCCAGG + Intergenic
920493999 1:206441230-206441252 GATTTTGAACAATTGGACCTAGG + Intronic
921798027 1:219370458-219370480 GATTATACAAAATTGGAGACAGG + Intergenic
1062984680 10:1757270-1757292 GAATTAGAAAAATTGGAGGTGGG - Intergenic
1065386839 10:25142458-25142480 GATTCAGAAAAATTGCAGCTAGG - Intergenic
1066462790 10:35626478-35626500 GATTAAGAAAGGTTGGTGTTAGG - Intergenic
1066748327 10:38625872-38625894 GATATTTAAAAATTTGAGTTTGG - Intergenic
1066968353 10:42291903-42291925 GATGTTTAAAAATTTGAGTTTGG + Intergenic
1069151625 10:64968189-64968211 TATTAAGAAAAATAGGAGTTGGG - Intergenic
1069283582 10:66685939-66685961 AACTATGAAAATTTAGAGTTGGG - Intronic
1069302451 10:66925709-66925731 GGTTAAGAAAAATTGACGTTCGG + Intronic
1071905637 10:90170427-90170449 GATAATGCAAAATGGGACTTAGG + Intergenic
1073876853 10:107934189-107934211 GATTATCATAGATTGTAGTTTGG + Intergenic
1074429946 10:113385908-113385930 AATCATAAAAAATTAGAGTTGGG - Intergenic
1074603462 10:114937705-114937727 AATTATTAAAAATTGTAGTGGGG + Intergenic
1078038942 11:7839304-7839326 TATAATATAAAATTGGAGTTTGG - Intergenic
1080477764 11:32611993-32612015 GACCTTGAAAAATTGCAGTTTGG + Intronic
1083375037 11:62213234-62213256 GCCTATGAAATATTGGAGCTGGG - Intronic
1086211994 11:84331877-84331899 GTTTCTGAAAAATTGGTGTTGGG + Intronic
1087453253 11:98352270-98352292 GATCCTGAAAGATTGGAGGTAGG - Intergenic
1088201897 11:107346037-107346059 GATTATAAGAAATTGTAGTCTGG - Intronic
1090233129 11:125124567-125124589 GATTATCAAATATTAGAATTGGG - Intergenic
1090552358 11:127836606-127836628 AATAAAGAAAAATTGGATTTAGG - Intergenic
1092495514 12:8989867-8989889 GAATATGAAAAGTTGGTGTATGG + Intronic
1092575065 12:9773607-9773629 GATTAAGACAAATGTGAGTTAGG - Intergenic
1093143060 12:15532692-15532714 GATTATGCAAAGTTGGAAGTTGG - Intronic
1093236164 12:16610412-16610434 GAATGTGAAAAATTGGAGGTTGG - Intronic
1094403739 12:30091971-30091993 GATTAAGAAAACTTGAATTTTGG + Intergenic
1094695307 12:32812270-32812292 GATTTTGAAAATTTGGATTAGGG + Intronic
1095380572 12:41585909-41585931 AATAATGAAAAACTAGAGTTGGG + Intergenic
1096336813 12:50763330-50763352 GATTAAGAAAAATCTGAGTAAGG + Intergenic
1098128732 12:67325912-67325934 GACTGGGAAAAATGGGAGTTGGG + Intergenic
1098579496 12:72082305-72082327 TATAATGAAAAATAGGAGTTTGG - Intronic
1099270805 12:80507756-80507778 TATGAAGAAAAATTGGAATTTGG - Intronic
1101160390 12:101968060-101968082 CATCCTGAAAAATTGCAGTTAGG - Intronic
1104164171 12:126210632-126210654 GATTATGAAAAGTATGAGTCAGG - Intergenic
1105845321 13:24289372-24289394 GATTTTGAAAAAATGAATTTGGG - Intronic
1106054289 13:26223441-26223463 AATTAGGTAAAAGTGGAGTTGGG - Intergenic
1106686527 13:32066075-32066097 GATTATAAAAAACTTGAGTATGG - Intronic
1107067457 13:36230441-36230463 TATTGTGAACAATTGCAGTTTGG + Intronic
1107762257 13:43692196-43692218 GATTCTGAAATAATGGTGTTGGG + Intronic
1108101736 13:46964333-46964355 TAATGTGAAAAATTTGAGTTTGG - Intergenic
1108365185 13:49704004-49704026 GATAATTAAAAATTGTAGTCAGG - Intronic
1109038751 13:57302940-57302962 GATTAAGAACATGTGGAGTTTGG - Intergenic
1110947304 13:81438840-81438862 GATCAAGAATATTTGGAGTTGGG + Intergenic
1111111747 13:83720358-83720380 GATTAAGTAAAATCGAAGTTAGG - Intergenic
1111214305 13:85123179-85123201 GATTAAGAAAATGTGGATTTTGG + Intergenic
1112952099 13:105011827-105011849 GATTCTGTGAAATTGGAATTTGG + Intergenic
1113063691 13:106353177-106353199 TAATAGGGAAAATTGGAGTTGGG + Intergenic
1113198796 13:107840918-107840940 GATTAGGAAAGATTTCAGTTAGG - Intronic
1116347571 14:43814540-43814562 GACTATAAAAAATTAGAATTTGG + Intergenic
1116474767 14:45326647-45326669 GATTATATAAATTTGGAGGTAGG - Intergenic
1116751964 14:48897808-48897830 GAAAATGAAGAATTGGAGGTTGG + Intergenic
1117678304 14:58177735-58177757 GATCATTAAAATTTGGAATTTGG - Intronic
1118205280 14:63716993-63717015 GATTTTTAAAAATTACAGTTGGG - Intronic
1118948795 14:70415232-70415254 TATTATTAAAAATTGGAAGTTGG - Intronic
1119749174 14:77065313-77065335 GATGATAAAAAATGGGAATTTGG + Intergenic
1119857938 14:77914883-77914905 GAGTATAAAGACTTGGAGTTGGG + Intronic
1120351161 14:83360112-83360134 AATTATTAAAAATTGTATTTGGG + Intergenic
1121355423 14:93210010-93210032 GATTAGGAAAAAGTGTAGATGGG - Intronic
1121621771 14:95355055-95355077 GATTATGAAACATGGGAGGGTGG + Intergenic
1122116333 14:99529188-99529210 GAGTTTGAAAAATGGGATTTCGG - Intronic
1124052742 15:26213689-26213711 GAAAATGAAAAAATGTAGTTGGG + Intergenic
1124468036 15:29957390-29957412 GATTTTGGAAAAGGGGAGTTTGG - Intronic
1126573934 15:50180013-50180035 TATTATTAAAAAGTGGGGTTAGG - Intronic
1126997437 15:54461203-54461225 GATTTTGAATATTTGGATTTGGG - Intronic
1127639619 15:60903756-60903778 AATTATGCAAAATCGGAGGTCGG + Intronic
1127721230 15:61701979-61702001 GTTTATGAAAAGTTGGAGTCAGG - Intergenic
1130242778 15:82212243-82212265 GATTATGACAAATCCCAGTTAGG + Intronic
1132308843 15:100840886-100840908 GATAATTCAAAAGTGGAGTTGGG + Intergenic
1133577045 16:7102004-7102026 GCTTATGTAAATTTGGAGTAAGG - Intronic
1133725698 16:8535469-8535491 CATAATGAATAATTGCAGTTTGG + Intergenic
1134171624 16:11974198-11974220 AATAATGAAAAAGTGGCGTTGGG - Intronic
1135159810 16:20083852-20083874 GATTTTTAAAAATTGTAGTAAGG - Intergenic
1135912712 16:26576238-26576260 GATAAAGAAAAATTGGAATCAGG - Intergenic
1136734434 16:32451429-32451451 GATGTTTAAAAATTTGAGTTTGG + Intergenic
1138751865 16:59432129-59432151 GAACATCAAAAATTAGAGTTAGG + Intergenic
1139042816 16:63018517-63018539 GATTATGAAAAACATGAGGTAGG + Intergenic
1139049217 16:63102680-63102702 GATTATCACAACTTGAAGTTTGG - Intergenic
1203018646 16_KI270728v1_random:378173-378195 GATGTTTAAAAATTTGAGTTTGG - Intergenic
1203036981 16_KI270728v1_random:651331-651353 GATGTTTAAAAATTTGAGTTTGG - Intergenic
1145276257 17:21433009-21433031 GATTTAGAAAAATGGGAGTTGGG - Intergenic
1145314099 17:21718923-21718945 GATTTAGAAAAATGGGAGTTGGG - Intergenic
1145712546 17:26990900-26990922 GATTTAGAAAAATGGGAGTTGGG - Intergenic
1146435697 17:32844855-32844877 GTTTATGAAACACTTGAGTTAGG + Intronic
1146949015 17:36892838-36892860 GAAAATGAAGAGTTGGAGTTTGG - Intergenic
1148012842 17:44498384-44498406 AATTAGGAAAGATTGGGGTTGGG - Intronic
1148448868 17:47760807-47760829 GATTATACAGAATTGGTGTTAGG + Intergenic
1148516604 17:48224344-48224366 CATAATGAGAAATTGGAGTGAGG - Intronic
1149446296 17:56715835-56715857 TATTATAAATAATTGGAGCTAGG - Intergenic
1149478022 17:56979613-56979635 AAGTAAGGAAAATTGGAGTTAGG + Intronic
1151208781 17:72528247-72528269 GATGATGAGAAAATGGAGTGCGG - Intergenic
1151666474 17:75548086-75548108 GATTTTGAAAGTTTGGATTTGGG + Intronic
1153682755 18:7515982-7516004 GATTATGCAAATTTGGGGTGAGG - Intergenic
1155238464 18:23844276-23844298 TATTATGAATAATGGTAGTTTGG - Intronic
1155758305 18:29530254-29530276 AATAATGAAAAATTTTAGTTTGG - Intergenic
1156416877 18:36903940-36903962 GATTCTGAAAAAGTGAAGTCTGG - Intronic
1157413387 18:47482323-47482345 AATTAGGAAAAATTGTAATTAGG - Intergenic
1159476425 18:68926036-68926058 AAATATTAAAAATTGGAATTAGG + Intronic
1159767514 18:72508350-72508372 GATATTTAAAAATTTGAGTTTGG + Intergenic
1160053363 18:75456753-75456775 GACTATGAAACATTGAAGGTAGG + Intergenic
1164483133 19:28631613-28631635 GTTTAGGAAAAATTGCAATTGGG - Intergenic
1164955620 19:32380964-32380986 AATTATGAATAATTGGTGATAGG - Intronic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1167118985 19:47505554-47505576 GATTTTTAACAATTGGGGTTTGG + Intronic
925350295 2:3196601-3196623 TATTATGAAAACTAGGAATTGGG - Intronic
925477181 2:4230294-4230316 GAACATGAAAAGTTGAAGTTGGG - Intergenic
927188931 2:20502798-20502820 GCTTATGGGAAAATGGAGTTAGG - Intergenic
927835096 2:26389942-26389964 GATAAATATAAATTGGAGTTAGG + Exonic
930952469 2:57159806-57159828 GAGGATGAAAAGTTGGAGTTGGG - Intergenic
933767745 2:85721871-85721893 GATTATGTAAATCTGGAGTTTGG + Intergenic
933829130 2:86192345-86192367 GATTAAGAAAAATTCCACTTTGG + Intronic
934311298 2:91868020-91868042 GATGTTTAAAAATTTGAGTTTGG - Intergenic
935643590 2:105313493-105313515 TATTATGTGAAATTGGAATTAGG - Intronic
936729421 2:115361919-115361941 TAATATGAAAATTTGGAGTTGGG - Intronic
936966846 2:118135272-118135294 TATAATAAAAAACTGGAGTTTGG - Intergenic
939518171 2:143195390-143195412 GATTATGAAAAGATGCATTTAGG + Intronic
939730102 2:145773308-145773330 GATTATGAAAAAAAAGAATTAGG + Intergenic
940029866 2:149250403-149250425 GATTAAGGAAGATTGGATTTAGG - Intergenic
940542654 2:155041532-155041554 GAATATGTAAAGTTGGTGTTTGG - Intergenic
941538693 2:166755291-166755313 TATTATGCAAAATTGTAGTGAGG - Intergenic
942593026 2:177566411-177566433 GAGTATGAAATATTGGGGTGGGG - Intergenic
943300897 2:186198141-186198163 GATTATTAATGATTGGACTTTGG - Intergenic
943484966 2:188467157-188467179 TATTTTCAAGAATTGGAGTTAGG + Intronic
943812031 2:192198648-192198670 GATTCAGAAAATCTGGAGTTGGG + Intergenic
945415094 2:209560910-209560932 GATTATGATAAATTGGACAGAGG + Intronic
946264273 2:218524953-218524975 GAAAATGAAAACTAGGAGTTAGG + Intronic
946846664 2:223865018-223865040 TATTATGAATAATGGGAGATAGG + Intronic
948604126 2:239123904-239123926 GAGGGTGAAAAATTGGGGTTAGG - Intronic
1169457001 20:5760718-5760740 GATTATGAAAAAGAGGAGGAAGG + Intronic
1169954464 20:11085540-11085562 GGTTATGGTAATTTGGAGTTAGG - Intergenic
1170099405 20:12682241-12682263 GTTTAGGAAAAAATGTAGTTTGG + Intergenic
1174226296 20:49003261-49003283 AATAATGAAAAATTGGGGCTGGG - Intronic
1174267695 20:49343921-49343943 GATTAGGAAACGTTGGAGCTGGG + Intergenic
1174315282 20:49695144-49695166 GATTATGAAAAATTGGAGTTAGG - Intronic
1177056117 21:16303558-16303580 GATCCTGAAATTTTGGAGTTTGG - Intergenic
1179003844 21:37491622-37491644 AATTTTTAAAAATTGGAGTAGGG + Intronic
1179993604 21:44961941-44961963 TATTATGAAAAATTTTATTTAGG + Intronic
1180538057 22:16413928-16413950 GATATTTAAAAATTTGAGTTTGG - Intergenic
1182185195 22:28394221-28394243 GATTATTAAAAAATAGGGTTGGG - Intronic
1182495327 22:30702978-30703000 AATTAAGAAAAATTCAAGTTTGG - Intronic
1183132175 22:35848957-35848979 TAGTAAGAAAAATTGAAGTTAGG - Intronic
1184906593 22:47491339-47491361 GAAAAAGAAAAATGGGAGTTGGG - Intergenic
949662486 3:6295231-6295253 CATTAAGAAATATTGTAGTTGGG + Intergenic
950911434 3:16598394-16598416 CATTATGAATAATGGGATTTGGG - Intronic
951424337 3:22525900-22525922 GATTGTGAAACATTGGATTAAGG - Intergenic
951852482 3:27157147-27157169 GATAATGATAAAATGGACTTTGG + Intronic
952696205 3:36267574-36267596 GATTTTGAAAACTTTGAGTTTGG - Intergenic
953517837 3:43613652-43613674 TATTATGAAAAATTTCAGTCAGG - Intronic
954605636 3:51907048-51907070 GGTTTTAAAAAATGGGAGTTTGG + Intergenic
956317847 3:67958928-67958950 GAATTTGAAAAATCGGACTTTGG - Intergenic
959908438 3:111735856-111735878 GATGAGGTAAAATTTGAGTTGGG + Intronic
960209494 3:114943215-114943237 GATTAAGACAATTTGAAGTTGGG - Intronic
960213123 3:114995922-114995944 TATTTTGAAAAGTTGGGGTTGGG - Intronic
961072673 3:123949656-123949678 TGAAATGAAAAATTGGAGTTGGG - Intronic
964364123 3:155930802-155930824 AATTATGAAAAATTATAATTTGG - Intronic
964596293 3:158434477-158434499 GATTAAGAAACATTCTAGTTTGG + Intronic
967206211 3:187124660-187124682 GAATATCAAAAATTGGACTCTGG + Intronic
967263438 3:187668901-187668923 AATTATGAAAAATGTGAATTTGG - Exonic
967653938 3:192022948-192022970 AATTAAGAAAAATTAGAATTAGG - Intergenic
967726227 3:192864806-192864828 GACTCTTAAAAATTGGAGTTGGG - Intronic
969133313 4:5009125-5009147 GATTAAAAAAAATTGGAGGACGG - Intergenic
970486038 4:16525793-16525815 GGATATGAAATGTTGGAGTTGGG + Intronic
970987847 4:22178695-22178717 GATAATGACAAATTGGAGATGGG + Intergenic
974624355 4:64402857-64402879 GATTATAAACAATGGGAGATTGG - Intronic
975169465 4:71216337-71216359 GATTTTTAAAAATTGGCATTTGG + Intronic
975297162 4:72748000-72748022 GAGTCTGACAAATTTGAGTTTGG + Intergenic
975909783 4:79253301-79253323 GAATATAAAAATGTGGAGTTTGG + Intronic
977257360 4:94756237-94756259 GATGATGAAAAATTGGATTGAGG + Intergenic
977820273 4:101463493-101463515 GAATATGAGAAATTGGTCTTTGG + Intronic
978712221 4:111797896-111797918 ACTTATGAAAAATGAGAGTTTGG + Intergenic
978958261 4:114641372-114641394 GATTATATTAAATTTGAGTTTGG + Intronic
979045803 4:115861621-115861643 GTTTATCAAAAATTGGCCTTAGG - Intergenic
979270486 4:118754617-118754639 GATGGTGAAAAACTGGATTTGGG + Intronic
979288330 4:118951724-118951746 TATTATGAAAAATTCACGTTTGG - Intronic
979436104 4:120693197-120693219 GATTACACAAAATTGGAATTTGG + Exonic
980533895 4:134090087-134090109 CATTAAGAAAAGGTGGAGTTGGG - Intergenic
982278610 4:153661953-153661975 GATTATGAAGAATGGGAAGTTGG + Intergenic
982554696 4:156844060-156844082 GATTTTGTTAATTTGGAGTTTGG - Intronic
982779769 4:159478898-159478920 GTTTATGGAAAATTGGAGAAAGG + Intergenic
982912151 4:161156592-161156614 TATTAGGAAAAACTGGAGCTGGG + Intergenic
983211841 4:164966608-164966630 GATTTTTAAAAATTGTACTTTGG + Intronic
983764525 4:171461725-171461747 GAAGATGAAAACTTGGAGTCAGG - Intergenic
985876580 5:2603374-2603396 GATTGTGACAAATGGGAGTCAGG - Intergenic
986054476 5:4122125-4122147 GATTATAAAAAACTTGATTTTGG - Intergenic
986226456 5:5819561-5819583 GTTTCTGACATATTGGAGTTGGG + Intergenic
987402060 5:17488077-17488099 GAGTATGAACAAGTGGAGTGTGG - Intergenic
987619519 5:20322260-20322282 CATTATGAACAATTGGTGTTTGG - Intronic
988342596 5:29993366-29993388 GATTATGTCAAATAGGAATTTGG + Intergenic
988982599 5:36586117-36586139 GATCATGAAGAATTTGAGCTGGG + Intergenic
989974986 5:50574052-50574074 GATAATGAAAATTTGGTGGTGGG + Intergenic
990069722 5:51766173-51766195 GATTATGCAAAAATGAATTTTGG - Intergenic
990839343 5:60059284-60059306 CATTCTGAGAACTTGGAGTTAGG - Intronic
995230226 5:109752858-109752880 GATTATTAACAAATGGAGCTGGG + Intronic
996035938 5:118758931-118758953 GTCTATGAAAAATTGGAACTGGG + Intergenic
996351058 5:122542286-122542308 GATAATGAGAAATAGGAGTGTGG + Intergenic
998858316 5:146417315-146417337 GAATATGAAAAATAGGAGCAGGG - Intergenic
999583448 5:153064748-153064770 GACTTTTAAAAATTGAAGTTTGG - Intergenic
1000152285 5:158515136-158515158 GACTAGGACAAAGTGGAGTTTGG + Intergenic
1000512900 5:162205921-162205943 GATTATGAAAAATGGGGGGATGG + Intergenic
1000890451 5:166795586-166795608 GAATAAGAAAACTTGGAGTTAGG + Intergenic
1000938814 5:167335706-167335728 GATTTTGAAAGATTAGAATTTGG - Intronic
1005050578 6:21680128-21680150 GATTATGAAAAACTGTTGCTGGG - Intergenic
1005077021 6:21918600-21918622 GATTATGAAGAACTGGGTTTGGG + Intergenic
1005867992 6:29950792-29950814 GTTTATGAAAAAGTGGAGGGAGG - Intergenic
1007259050 6:40549600-40549622 GATTATGATAATCTGGAGTCTGG + Intronic
1007320600 6:41026361-41026383 CATTTTGAGAAATTGGAGTTGGG + Intergenic
1008399308 6:51046408-51046430 GATTTTGCAAAAATGAAGTTGGG - Intergenic
1008720631 6:54346114-54346136 GATTATGAAAAAATTGGGGTGGG - Intronic
1008923851 6:56870898-56870920 GAGTATCAAAAGTAGGAGTTAGG + Intronic
1009305303 6:62082619-62082641 GATGTTTAAAAATTGGAATTGGG + Intronic
1009406713 6:63322787-63322809 GATTAAAAAATATTGGAGTGAGG + Intergenic
1010390052 6:75326536-75326558 TATTAGCAAATATTGGAGTTGGG - Intronic
1011384589 6:86781602-86781624 GAATATGAAATATGGAAGTTAGG - Intergenic
1011563680 6:88649980-88650002 AATCATGAAAAATTATAGTTTGG - Intronic
1012645070 6:101668311-101668333 GCTGATAAAAAATTGGAGATTGG + Intronic
1013132285 6:107244595-107244617 GAATATGAAGAATTGCACTTTGG - Intronic
1013384682 6:109614429-109614451 CAATATGAAAAAATGGAGTTTGG - Exonic
1013971680 6:116027528-116027550 AATTTAGAAAAATTGGAGTTTGG + Intronic
1014139297 6:117921871-117921893 GATTATGAAAAAATGTAAATGGG + Intronic
1014256531 6:119165797-119165819 TTATATGAAAATTTGGAGTTAGG + Intergenic
1015351225 6:132222317-132222339 GATTAAAAAAAAACGGAGTTAGG + Intergenic
1015676843 6:135760270-135760292 GATTTTTAAAAAATGGAGTAGGG - Intergenic
1015931152 6:138361096-138361118 AATTATAAAATACTGGAGTTTGG - Intergenic
1016473880 6:144405241-144405263 AATTATGAATATTTGGAGATGGG + Intronic
1016566295 6:145458605-145458627 CATTGTGAGAAAGTGGAGTTTGG + Intergenic
1017265654 6:152442599-152442621 AATTTTTAAAAATTGGAGTTGGG - Intronic
1018478010 6:164162028-164162050 GATTTGGAAAACTTGGAGGTAGG + Intergenic
1018977804 6:168578772-168578794 TATTATGAAGAATTGGACGTGGG + Intronic
1019159176 6:170057852-170057874 GATTATGAGAATTTCCAGTTTGG - Intergenic
1020951423 7:14683100-14683122 TATTGTGAAAAATTTGAGTGAGG - Intronic
1021387243 7:20046089-20046111 GATTATAAAAACTTGGAGGTAGG - Intergenic
1021481674 7:21124665-21124687 GATTTTAAAAAATCAGAGTTGGG + Intergenic
1021543318 7:21784844-21784866 TGATATGAAAAATTGGATTTGGG - Intronic
1025192264 7:56904933-56904955 GATGATGAAAAATGGGAGTGAGG - Intergenic
1025679684 7:63671999-63672021 GATGATGAAAAATGGGAGTGAGG + Intergenic
1025909090 7:65813005-65813027 GAACATGAAAAACTGGAGTTTGG - Intergenic
1026867557 7:73832842-73832864 AATTGTGAAAAATTGGAGCTGGG + Intergenic
1027544228 7:79505934-79505956 GATGTTGAAAATTTGGAATTTGG - Intergenic
1028369022 7:90069971-90069993 GATTTGAAAAATTTGGAGTTGGG + Intergenic
1029175016 7:98658498-98658520 GATTTTTAAAAATTTGAATTTGG - Intergenic
1030148748 7:106381949-106381971 GATGCTGAAAAATTGGAATTTGG + Intergenic
1030214163 7:107026805-107026827 TATTTTTAAAAATTGGACTTTGG + Intergenic
1032227311 7:130042978-130043000 GATTATTAAAAACTGAAGCTGGG - Intronic
1032991913 7:137403241-137403263 CTTTATGAAAAACTGGAATTTGG - Intronic
1034140331 7:148809826-148809848 GATTATGTGAAAATGGAGGTAGG - Intronic
1034325052 7:150222114-150222136 GATTATTCCAACTTGGAGTTGGG - Intergenic
1036032245 8:4987191-4987213 GATTCTGAATAAGTGGATTTTGG - Intronic
1037428738 8:18786570-18786592 CATTAGGAAAAATAGCAGTTAGG + Intronic
1037558104 8:20046119-20046141 GATTATGAAGGGCTGGAGTTTGG + Intergenic
1038929900 8:32182114-32182136 CATTATGAAAAAGAGGAGCTGGG + Intronic
1042438673 8:68798647-68798669 TATAATGAAAAATTGCAATTTGG - Intronic
1042517462 8:69674537-69674559 GATTGTGAAAAAGTCTAGTTGGG - Intronic
1042722267 8:71839418-71839440 GAGTTTGAGAAATGGGAGTTGGG - Intronic
1042769919 8:72368429-72368451 GAGAATGAAACATTGGACTTTGG + Intergenic
1043956574 8:86366717-86366739 GATTATCAAAAATCCCAGTTTGG + Intronic
1044065595 8:87695720-87695742 AATTATGAAAAATTAAAATTAGG - Intergenic
1046637506 8:116687152-116687174 GATAATGAAAGCCTGGAGTTAGG + Intronic
1046849262 8:118953812-118953834 AGCTAGGAAAAATTGGAGTTGGG - Intergenic
1047117480 8:121860549-121860571 GATGATGATAAAGTGGAGTGAGG - Intergenic
1047492327 8:125385280-125385302 GAGTTTGAATATTTGGAGTTTGG - Intergenic
1047900517 8:129416505-129416527 GATAATCAAAATTTGGAATTTGG + Intergenic
1048725743 8:137381755-137381777 AATTATGACAAATTGAAGATCGG + Intergenic
1050406216 9:5311170-5311192 GATTAGGAAAAACTGAAGATTGG + Intergenic
1050760021 9:9057375-9057397 CATTATGATAAAATGGAGATGGG - Intronic
1051385920 9:16508672-16508694 GTGTATGAAAATTTGGATTTGGG - Intronic
1051741063 9:20252805-20252827 GAGTATGAAAATTTGGAGTGGGG - Intergenic
1051965366 9:22822195-22822217 AGTTATTAAAATTTGGAGTTAGG - Intergenic
1053005962 9:34604797-34604819 GGTTAAGAAAAACTGGAGTGGGG + Intergenic
1053190243 9:36059553-36059575 GATTTTGGAAAATTGAATTTGGG + Intronic
1055761140 9:79609752-79609774 GATTCTGAAATATTGCTGTTAGG - Intronic
1056867490 9:90242260-90242282 GATTATGACAATATGGATTTGGG - Intergenic
1057738085 9:97685696-97685718 GATTATGTTAAATTTGAGTTTGG - Intronic
1057853742 9:98585847-98585869 GATTTTGAATATTTGGATTTGGG + Intronic
1058788428 9:108415969-108415991 GAATTGGTAAAATTGGAGTTGGG - Intergenic
1185863294 X:3599718-3599740 AGTTATGAAAAATAGGAGCTTGG + Intergenic
1186957909 X:14703141-14703163 GAATGTGTAAAATTTGAGTTTGG + Intronic
1187152655 X:16695107-16695129 GATTTTCAAAAATTAGATTTTGG - Intronic
1188412020 X:29884688-29884710 GATTTTGAACATATGGAGTTTGG - Intronic
1189646295 X:43136163-43136185 GATTATGAAAAGTCTGAATTCGG + Intergenic
1190039514 X:47058580-47058602 GATTTGGCAAACTTGGAGTTAGG - Exonic
1190842991 X:54163676-54163698 GATTTTTAAAAATTGGAGCTAGG + Intronic
1194019935 X:88675466-88675488 GATTACTAGAAAATGGAGTTAGG + Intergenic
1195159822 X:102160361-102160383 AATTATGATACAGTGGAGTTTGG + Intergenic
1195265481 X:103175494-103175516 GAGTAGGGAGAATTGGAGTTGGG - Intergenic
1197096232 X:122599169-122599191 GATGGTGAATAGTTGGAGTTAGG + Intergenic
1199073655 X:143506844-143506866 GAGAATGAAACATTGGAGGTGGG + Intergenic