ID: 1174320371

View in Genome Browser
Species Human (GRCh38)
Location 20:49737085-49737107
Sequence GAGGCTAGGAGTTCGAGACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174320371_1174320380 22 Left 1174320371 20:49737085-49737107 CCTCGTCTCGAACTCCTAGCCTC No data
Right 1174320380 20:49737130-49737152 TCTCAAAATGCTGGGGTTACAGG 0: 21
1: 1086
2: 30332
3: 328588
4: 262510
1174320371_1174320377 14 Left 1174320371 20:49737085-49737107 CCTCGTCTCGAACTCCTAGCCTC No data
Right 1174320377 20:49737122-49737144 CCTTAGCCTCTCAAAATGCTGGG 0: 15
1: 956
2: 22768
3: 217036
4: 319529
1174320371_1174320375 13 Left 1174320371 20:49737085-49737107 CCTCGTCTCGAACTCCTAGCCTC No data
Right 1174320375 20:49737121-49737143 GCCTTAGCCTCTCAAAATGCTGG No data
1174320371_1174320378 15 Left 1174320371 20:49737085-49737107 CCTCGTCTCGAACTCCTAGCCTC No data
Right 1174320378 20:49737123-49737145 CTTAGCCTCTCAAAATGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174320371 Original CRISPR GAGGCTAGGAGTTCGAGACG AGG (reversed) Intergenic
No off target data available for this crispr