ID: 1174327605

View in Genome Browser
Species Human (GRCh38)
Location 20:49791687-49791709
Sequence CTGTAGTCCCAGGCTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174327597_1174327605 19 Left 1174327597 20:49791645-49791667 CCATCTCTACCAAAAAAAAAAAA 0: 820
1: 5215
2: 23414
3: 366672
4: 261799
Right 1174327605 20:49791687-49791709 CTGTAGTCCCAGGCTGAGGAGGG No data
1174327598_1174327605 10 Left 1174327598 20:49791654-49791676 CCAAAAAAAAAAAAATTAAGTGG No data
Right 1174327605 20:49791687-49791709 CTGTAGTCCCAGGCTGAGGAGGG No data
1174327596_1174327605 24 Left 1174327596 20:49791640-49791662 CCACTCCATCTCTACCAAAAAAA 0: 3
1: 13
2: 79
3: 434
4: 1225
Right 1174327605 20:49791687-49791709 CTGTAGTCCCAGGCTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174327605 Original CRISPR CTGTAGTCCCAGGCTGAGGA GGG Intergenic
No off target data available for this crispr