ID: 1174327868

View in Genome Browser
Species Human (GRCh38)
Location 20:49793776-49793798
Sequence TCTCCTTGCCCACTATCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174327867_1174327868 -1 Left 1174327867 20:49793754-49793776 CCTTTACAGGAACATGTCATGGT No data
Right 1174327868 20:49793776-49793798 TCTCCTTGCCCACTATCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174327868 Original CRISPR TCTCCTTGCCCACTATCCCA TGG Intergenic
No off target data available for this crispr