ID: 1174332256

View in Genome Browser
Species Human (GRCh38)
Location 20:49829736-49829758
Sequence CTTGTCATCAGCAGAATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174332256_1174332259 -1 Left 1174332256 20:49829736-49829758 CCCACAATTCTGCTGATGACAAG 0: 1
1: 1
2: 1
3: 12
4: 172
Right 1174332259 20:49829758-49829780 GAATCGGCTTAATTCCAGTGAGG 0: 1
1: 0
2: 1
3: 2
4: 44
1174332256_1174332260 10 Left 1174332256 20:49829736-49829758 CCCACAATTCTGCTGATGACAAG 0: 1
1: 1
2: 1
3: 12
4: 172
Right 1174332260 20:49829769-49829791 ATTCCAGTGAGGAGAGAAGCAGG 0: 1
1: 2
2: 3
3: 31
4: 297
1174332256_1174332262 21 Left 1174332256 20:49829736-49829758 CCCACAATTCTGCTGATGACAAG 0: 1
1: 1
2: 1
3: 12
4: 172
Right 1174332262 20:49829780-49829802 GAGAGAAGCAGGCCAAACTCAGG 0: 1
1: 1
2: 1
3: 23
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174332256 Original CRISPR CTTGTCATCAGCAGAATTGT GGG (reversed) Intronic
901954011 1:12770982-12771004 CCTGTCATCAGCAGTAATGAAGG - Intergenic
906946006 1:50294956-50294978 CTTATAATCTGCAGCATTGTTGG - Intergenic
907156002 1:52334515-52334537 GTTGTAAGCATCAGAATTGTTGG + Intronic
916646460 1:166790703-166790725 TTTTTTATCAGAAGAATTGTTGG + Intergenic
918176260 1:182048340-182048362 CTGATCAACAGCACAATTGTTGG + Intergenic
918448390 1:184636152-184636174 CATTTCGGCAGCAGAATTGTTGG - Intergenic
918477369 1:184939640-184939662 CTTGTCACCAGAAAAACTGTGGG + Intronic
919294781 1:195683148-195683170 CTTGTAATGGGCATAATTGTTGG - Intergenic
920235432 1:204500213-204500235 CTTTTGATCTGCAGAACTGTAGG + Intergenic
921847114 1:219895645-219895667 GTTGTCCTCAGCAGAAGAGTTGG - Intronic
1062890875 10:1058624-1058646 ATTGTCATCCACAGAATTGATGG + Intronic
1063159417 10:3408598-3408620 CTTGTCACCATCTGAAATGTGGG - Intergenic
1063600844 10:7480046-7480068 GTTGTCATCTGGCGAATTGTGGG + Intergenic
1065138664 10:22699195-22699217 TTTGGCATCAGAAGAACTGTTGG - Intronic
1066296930 10:34062195-34062217 ATTGTTATCAGCAGAATAATTGG - Intergenic
1070888375 10:79924007-79924029 ATGGTCATGAGCAGAACTGTGGG - Intergenic
1072031574 10:91526967-91526989 CTTTTCATCTCCAGAACTGTGGG - Intergenic
1073758920 10:106609920-106609942 CTTCTCATCTGCAGCATTCTAGG - Intronic
1075083713 10:119400414-119400436 CTTGTAATTGGCAGAATTGTGGG + Intronic
1076151580 10:128166367-128166389 CTTGTCAAAACCAGTATTGTTGG + Intergenic
1080590536 11:33719664-33719686 CTTGTCATCTGCAAAAAAGTTGG - Intronic
1081348718 11:42022572-42022594 CTTGTCATCAACAGCATAGAGGG - Intergenic
1081365261 11:42227105-42227127 CTTGTTAGCTGCAGAACTGTGGG + Intergenic
1082219876 11:49621758-49621780 CTTGTCATGAGAAGAATTTTTGG + Intergenic
1085975546 11:81648971-81648993 TTTTTCATCAGTAAAATTGTAGG + Intergenic
1086629749 11:89003028-89003050 CTTGTCATGAGAAAAATTTTTGG - Intronic
1090380661 11:126325238-126325260 CTTCTCTTCAGCATAATTTTTGG - Intronic
1091154148 11:133358239-133358261 CTTGTCATCACTTGTATTGTTGG + Intronic
1091200492 11:133776639-133776661 GTTGTCTCCAGCAGCATTGTAGG - Intergenic
1093354101 12:18141795-18141817 CTTGTCATGAAAATAATTGTGGG - Intronic
1095840014 12:46682702-46682724 CTTGTCATCAGCAGAGTTGGAGG + Intergenic
1096140425 12:49238242-49238264 TTTCACATTAGCAGAATTGTGGG - Intronic
1096653655 12:53075094-53075116 CTTGCCATCATCAGCATGGTAGG + Exonic
1097926968 12:65139418-65139440 CTTGTGATTGGGAGAATTGTAGG - Intergenic
1098837230 12:75438143-75438165 CTTGACCTCAGCTGAATTGTGGG - Intergenic
1101137099 12:101755304-101755326 CTTGTCTTCTTCAGAAGTGTAGG - Intronic
1101453444 12:104804195-104804217 CTGGTCAGCAGCAAAATTTTTGG + Exonic
1102069754 12:110008475-110008497 TTTGTCATCAGGATAATAGTGGG + Intronic
1103397966 12:120622465-120622487 CTTGTCATCAGCAGAGTGTCTGG + Intergenic
1103423971 12:120815042-120815064 CTTGTTAACAGCAGAGTTTTTGG - Intronic
1107033298 13:35875558-35875580 CTTCTTATCAGAAGAAATGTAGG + Intronic
1107152828 13:37131710-37131732 CTTGTGACCAACAGAACTGTGGG + Intergenic
1109792737 13:67270658-67270680 GTTGTCACCAGCAGACATGTTGG - Intergenic
1113596300 13:111536588-111536610 TTTCTCATCAGAAGAAATGTCGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114216517 14:20661347-20661369 TTGGTCATCAGCAAAAGTGTGGG - Intergenic
1119809003 14:77500491-77500513 CTTGTCATCTGTAAAAGTGTGGG + Intergenic
1121742075 14:96261022-96261044 GTTGTCATCAGCTGAAATGAAGG - Intronic
1122867917 14:104617507-104617529 CTTCTCATCCGCAGCATTGGGGG - Intergenic
1123670723 15:22654267-22654289 CTTTTCAACAGCTGAATTGTGGG - Intergenic
1124356554 15:28999665-28999687 CCTTTCATGAGCAGAATTGCTGG - Intronic
1124551130 15:30682416-30682438 CGTGCCATCAGCTGAATAGTTGG + Intronic
1127935827 15:63636631-63636653 CTTGTCATCACCATTATTTTAGG - Intronic
1129689925 15:77707419-77707441 TTTCTCATCTGCAGAATGGTTGG - Intronic
1130374657 15:83318068-83318090 CTTCTCACCAACAGAATTCTTGG - Intergenic
1132930431 16:2456333-2456355 CTTGTCATCTCCACATTTGTTGG + Intronic
1133309218 16:4832192-4832214 CTTGTCATCAGAAGAATTGTGGG + Exonic
1134608431 16:15589332-15589354 CTTTTCAGCATCAGAATGGTGGG - Intronic
1137821165 16:51447488-51447510 CTTGTCATCCTCAGCATTTTGGG + Intergenic
1140273639 16:73488321-73488343 CTTTTCATCAGCACTATAGTAGG - Intergenic
1144174118 17:12688194-12688216 ATTGTCAACAGCAGACTTCTGGG + Intronic
1144310035 17:14005395-14005417 CTTGTCATCAGCTTAAGGGTTGG + Intergenic
1144399944 17:14886561-14886583 CTTGCCATCAGCAGACCGGTAGG - Intergenic
1146380244 17:32322606-32322628 CTTTGCCTCAGGAGAATTGTTGG + Exonic
1148755520 17:49971140-49971162 CTTGTCCTCAGGGGAATTGCTGG + Intronic
1149417669 17:56477290-56477312 CTTACCTTCAGCAGAATTCTTGG - Intronic
1150271793 17:63871598-63871620 CTTGTGTTCAGAAGAATTTTAGG - Intergenic
1152097344 17:78279620-78279642 CTGGTCATCAGCAGGAATGCAGG + Intergenic
1153642801 18:7170576-7170598 CTTCTCTTCAGCAAAACTGTAGG - Intergenic
1156764323 18:40632906-40632928 TATGTCATTAGCAGAATTGTTGG + Intergenic
1157530654 18:48418009-48418031 GGTGTCATCAGCAGAATGGATGG - Intergenic
1158887490 18:61842166-61842188 AATGTCATAAGCAGAATTGCTGG - Intronic
1159194486 18:65095005-65095027 GTTTTCATTAGCAGAATTATGGG - Intergenic
1159793241 18:72810658-72810680 TGTGTCTTAAGCAGAATTGTAGG - Intronic
1163286265 19:16350161-16350183 CCTGTCATCAGCAGCACTTTGGG + Intergenic
1163797687 19:19346767-19346789 CCTGTCATCAGCAGCATTTCTGG + Intronic
1164502046 19:28828371-28828393 TGTGTGATCAGCAGAATTCTCGG - Intergenic
1164783168 19:30909735-30909757 CATGTCATCAGCCGAAGTGCTGG + Intergenic
1164955523 19:32379929-32379951 CTTGTGAACACCAGAATTGTGGG + Intronic
925457297 2:4027065-4027087 CTTGGCAAGAGCAGAGTTGTTGG + Intergenic
927667045 2:25040183-25040205 TTTGTGTTGAGCAGAATTGTGGG + Intergenic
929748321 2:44682872-44682894 CTGGTAATCAAAAGAATTGTTGG + Intronic
931263632 2:60641078-60641100 CATGCCATCAGCAGCAGTGTAGG + Intergenic
931341740 2:61408543-61408565 CTGTTAATCAGAAGAATTGTAGG - Intronic
932099501 2:68884942-68884964 CTTGTCTGCAGTAGAATTTTGGG + Intergenic
932535794 2:72593374-72593396 ATTGTTATCAGCAGTATTGTAGG + Intronic
935903211 2:107814773-107814795 CTTGTGACCTGCAGAATCGTGGG + Intergenic
936960193 2:118065174-118065196 CTTGTTATCAGCAGGATTCGTGG - Intergenic
937019723 2:118639467-118639489 CTTAGCATCCGCAGATTTGTGGG - Intergenic
938783706 2:134607368-134607390 CTTTTCATCAGCACAGTTCTCGG - Intronic
938783710 2:134607399-134607421 CTTTTCATCAGCACAGTTCTCGG - Intronic
938783782 2:134607842-134607864 CTTTTCATCAGCACAGTTCTCGG - Intronic
938783940 2:134608815-134608837 CTTTTCACCAGCACAATTCTCGG - Intronic
940449553 2:153819518-153819540 CTTGCCATCAGGACATTTGTGGG + Intergenic
942821457 2:180120697-180120719 CTGGTCATCAGAAGTATGGTAGG - Intergenic
946196964 2:218039196-218039218 CTTGCCAGTGGCAGAATTGTAGG + Intronic
948800597 2:240431728-240431750 CTTTTGATCAGCAGAAGTCTGGG - Intergenic
1169585711 20:7082258-7082280 CTTGTCATCAAAAGAATTTTGGG + Intergenic
1171713928 20:28446173-28446195 TTTGTCATCAGGATAATAGTGGG + Intergenic
1173786380 20:45795826-45795848 CTTGTCATCAGTGGTATTTTGGG + Intronic
1174332256 20:49829736-49829758 CTTGTCATCAGCAGAATTGTGGG - Intronic
1178394989 21:32235218-32235240 ATTGTCTTCAGCGGAATTGGAGG + Intergenic
1183794779 22:40107368-40107390 GCTGTCCTCAGCAGAATGGTTGG + Intronic
1183800800 22:40162759-40162781 CTAGACATCAGAAGAATAGTTGG + Intronic
949159964 3:869643-869665 CATTTCATCAGCAGCATTCTTGG + Intergenic
949201256 3:1382177-1382199 CTTGCCATCAGGAGATATGTTGG + Intronic
949534297 3:4983941-4983963 CTTGACATCAGGAGACTTGGGGG + Exonic
951493910 3:23303681-23303703 CTTGAAATCTGAAGAATTGTTGG + Intronic
955498250 3:59559045-59559067 CTTCTCATCAAGATAATTGTGGG - Intergenic
956320224 3:67988347-67988369 CTTCTCATTAGCAAAATTGTAGG + Intergenic
956957821 3:74361056-74361078 CTTGTGATAAGCAGAATAATTGG - Intronic
959383437 3:105671332-105671354 CCTGTCCTCAGAAGAATTGACGG - Intronic
966253169 3:177889553-177889575 CTTGACATGGGCAGAATTATGGG + Intergenic
966694987 3:182780056-182780078 TTTGTAGTCGGCAGAATTGTTGG + Intergenic
967718737 3:192792633-192792655 CTTTTCATCAGCAGAATAGATGG - Intergenic
970178662 4:13364803-13364825 CTTGTCATCAGCACCATCCTCGG + Intronic
971343011 4:25787825-25787847 ATTTTCATCAGCAGGATTGTTGG + Intronic
972197318 4:36669861-36669883 CTGATCATCAACAAAATTGTTGG - Intergenic
975354693 4:73387662-73387684 CTTGACATAAGCAGAATGTTTGG - Intergenic
984240968 4:177218866-177218888 CTTGTAATCAGCAGAAAGGAAGG - Intergenic
984738794 4:183138815-183138837 GTTGTCTTAAGCAGGATTGTTGG + Intronic
984983856 4:185308437-185308459 CTTGGCAACAGCAGATTTGGTGG + Intronic
986494900 5:8332106-8332128 CTGGTCTTCAGCAGAATTCAGGG - Intergenic
988220102 5:28333699-28333721 CCTGCCCTCAGCAGAACTGTAGG - Intergenic
989106772 5:37870243-37870265 ATTTTCATCAGCAGAGTTCTTGG + Intergenic
990493582 5:56324945-56324967 CCTGTCATCAAAAGAAATGTTGG - Intergenic
991002050 5:61792486-61792508 CTTGTCCTCATCAGAAATCTAGG - Intergenic
991152352 5:63385150-63385172 CTAGTCATCAGCAGCCTTGCTGG - Intergenic
992304682 5:75424089-75424111 GTTGACATCAGCAGTATTTTTGG + Intronic
993284380 5:85972442-85972464 CTTGCCAAGAGCAGAATTATTGG - Intergenic
993952257 5:94191145-94191167 CTTGTCATCAGGTAACTTGTAGG + Intronic
994916900 5:105992455-105992477 CTTGTGATAAGCAGAGATGTAGG + Intergenic
995249372 5:109972891-109972913 GTTGTCATCAGTAGCTTTGTGGG + Intergenic
995785994 5:115828391-115828413 CTTGCTATTAGCAGAGTTGTGGG - Exonic
996107968 5:119528679-119528701 CTATTCATCACCAGAATTGCAGG - Intronic
996325149 5:122264688-122264710 CTTGTACTCAGCTTAATTGTAGG + Intergenic
998789518 5:145751235-145751257 CTTGCCATCAGCAGCATCATGGG - Intronic
1000633931 5:163622033-163622055 CTTGTCCTCAACAGATTTGTAGG + Intergenic
1003785252 6:9478595-9478617 ATTGTGCTCAGCACAATTGTAGG - Intergenic
1004049937 6:12067034-12067056 ATTTTCATCAGCAGATTTGGTGG + Intronic
1005181211 6:23109016-23109038 CTTGTCCTGAAGAGAATTGTTGG - Intergenic
1006000843 6:30963928-30963950 CTTTACATCAGCAGAACTGCTGG - Intergenic
1008430481 6:51410789-51410811 TTTGGCATCAGGAGAATGGTTGG - Intergenic
1009533406 6:64850027-64850049 CCTGTAATAAGCAAAATTGTAGG - Intronic
1011406755 6:87023127-87023149 GATGGCATCAGCAGAATTTTAGG + Intergenic
1013454178 6:110315115-110315137 CTTGCTATCAGCAGAATGGGAGG + Intronic
1013845742 6:114448834-114448856 CTTTTTATCAACAGAATTGAGGG + Intergenic
1014703683 6:124720888-124720910 CTTATCCTCAGCAGTATAGTGGG + Intronic
1017059260 6:150466379-150466401 CTACACATCAGCAGAATTGCTGG - Intergenic
1018471763 6:164103746-164103768 TTTCTCATCAGCTGAATGGTGGG - Intergenic
1020828053 7:13056714-13056736 CTAGACATCAGCAGATTTGATGG - Intergenic
1022179107 7:27900925-27900947 CTTTTCATAAGCTGAATGGTAGG - Intronic
1022426528 7:30273722-30273744 CTTGTTATCAGCAGAAACTTAGG - Intergenic
1022604375 7:31794681-31794703 CTTATCATCAGAGGAGTTGTAGG - Intronic
1022694920 7:32695271-32695293 CGTGTCATCAGAACAATTCTTGG + Intergenic
1024631300 7:51249677-51249699 CTGATCAACAGAAGAATTGTAGG - Intronic
1028453809 7:91016622-91016644 CAGGTCTTAAGCAGAATTGTAGG + Intronic
1028623814 7:92854576-92854598 CTTGCCATCATCAGACTTCTAGG + Intergenic
1030184666 7:106750054-106750076 TTTGCCATCAGCAGAAATGGGGG - Intergenic
1037152871 8:15658961-15658983 CTTGTTAAGAGCAGAAATGTTGG + Intronic
1038303730 8:26380294-26380316 CTTGTCGTTAACAAAATTGTTGG + Intergenic
1038860121 8:31378218-31378240 CTTGTCATCAGAAGCAGTGGAGG - Intergenic
1041679235 8:60570156-60570178 CTTGGTATCAGCAGCATTGATGG + Intronic
1043113835 8:76222475-76222497 CATTTCATGAGCAGAAGTGTAGG - Intergenic
1043386820 8:79757282-79757304 CCTGTCATCAGCTAAAATGTGGG + Intergenic
1044065787 8:87698751-87698773 CTTGTCATGTGGATAATTGTAGG - Intergenic
1044638977 8:94358628-94358650 CTTGGAATCAGCAGATTTGGAGG - Intergenic
1047307739 8:123666620-123666642 CGTGTCTTCAGCAGAGCTGTGGG + Intergenic
1047828802 8:128609444-128609466 TTTGTCATCAGCAGGAATGGGGG - Intergenic
1048311407 8:133325034-133325056 TTTGTTATCTACAGAATTGTTGG - Intergenic
1048483657 8:134827379-134827401 TTTGTGATCTGCAGAACTGTAGG - Intergenic
1048973559 8:139658412-139658434 CTTGTGTTCAGCAACATTGTGGG - Intronic
1049763772 8:144343470-144343492 CTTGTCACCAGCAGCCTTGAGGG + Intergenic
1050434390 9:5593509-5593531 TTTGGTATCAGCAGTATTGTGGG + Intergenic
1053552388 9:39097603-39097625 CTTGTCATCCCCAGTTTTGTAGG - Intronic
1053816509 9:41917767-41917789 CTTGTCATCCCCAGTTTTGTAGG - Intronic
1054106770 9:61061449-61061471 CTTGTCATCCCCAGTTTTGTAGG - Intergenic
1054614087 9:67269676-67269698 CTTGTCATCCCCAGTTTTGTAGG + Intergenic
1055389627 9:75806054-75806076 CTTGTGAGCTTCAGAATTGTAGG + Intergenic
1056457384 9:86773807-86773829 TTTGTCTTCAGAAGAATTCTAGG + Intergenic
1060407588 9:123380581-123380603 CTTGTCATCTGGAGCTTTGTGGG - Exonic
1062218038 9:135399693-135399715 CTTGTCCCCAGCAGCATGGTCGG + Intergenic
1189645097 X:43119677-43119699 TTTCTCATCTGCAGAAATGTAGG + Intergenic
1193516923 X:82477204-82477226 CTTATCAACAGCAAACTTGTAGG - Intergenic
1198455866 X:136817032-136817054 GTTCTCATCACCAAAATTGTTGG + Intergenic
1198775518 X:140175103-140175125 CATGTTAACAACAGAATTGTTGG - Intergenic
1199745446 X:150769530-150769552 CCCGTCTTCAGCAGCATTGTAGG + Intronic