ID: 1174332343

View in Genome Browser
Species Human (GRCh38)
Location 20:49830342-49830364
Sequence CATCTAGGAGGGGGCCCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174332336_1174332343 4 Left 1174332336 20:49830315-49830337 CCGCACTGCCAAGAAACGTGATT 0: 1
1: 0
2: 0
3: 4
4: 104
Right 1174332343 20:49830342-49830364 CATCTAGGAGGGGGCCCGCCTGG 0: 1
1: 0
2: 1
3: 3
4: 89
1174332337_1174332343 -4 Left 1174332337 20:49830323-49830345 CCAAGAAACGTGATTTGTTCATC 0: 1
1: 0
2: 2
3: 7
4: 121
Right 1174332343 20:49830342-49830364 CATCTAGGAGGGGGCCCGCCTGG 0: 1
1: 0
2: 1
3: 3
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174332343 Original CRISPR CATCTAGGAGGGGGCCCGCC TGG Intronic
900115348 1:1025706-1025728 CAGCTGGGAGGGGGTCTGCCGGG + Intronic
903006680 1:20303321-20303343 CATCTAGGAGGGATCAGGCCAGG + Intronic
903198648 1:21713920-21713942 CAACTAGGAAGGGGCCATCCTGG - Intronic
904347961 1:29885834-29885856 CAGCTAGGAGGGGGTCATCCAGG - Intergenic
906697065 1:47830150-47830172 CATCTGGGAGGGGGACATCCTGG - Intronic
908664578 1:66475990-66476012 CCTCTAGGAGGGGGAACGCTGGG + Intergenic
911186791 1:94912455-94912477 ACTCTAGGAGGGCGCCTGCCGGG - Intronic
920031335 1:203039029-203039051 AATCAATGAGGGGGACCGCCTGG + Intronic
1067162098 10:43835946-43835968 CATCTAGCAGGTGCCCCTCCAGG - Intergenic
1069564006 10:69451365-69451387 CGTCTGGGAGGGGGCGGGCCAGG - Intergenic
1077372948 11:2192233-2192255 CACCTAGCAGGGGCCCCTCCAGG - Intergenic
1083879518 11:65541095-65541117 GATCTGGGAAGGGGCCTGCCCGG + Intronic
1089607952 11:119652432-119652454 CTTCTAGGAGGGCCCCCACCTGG + Intronic
1090189989 11:124761264-124761286 CATCTGGGAGAGGACCCGGCAGG - Intronic
1104809918 12:131613911-131613933 CAGCTGGGACGGAGCCCGCCGGG - Intergenic
1104973208 12:132540752-132540774 CATCGGGGAGGGGCCCCCCCGGG - Intronic
1113869162 13:113547494-113547516 CATCTCGGAGGAGGCCCACTGGG + Intronic
1114433877 14:22686770-22686792 CATCTAGGAGGTGCCCCTCTGGG + Intergenic
1116817546 14:49598278-49598300 GAACTAGGACGGGGCCCGGCTGG - Intronic
1119882786 14:78114147-78114169 CATCTTGGAGGAGGCCTGGCTGG + Intergenic
1120830847 14:88996171-88996193 CCTCCAGGTGGGGGCCTGCCTGG + Intergenic
1121777946 14:96603111-96603133 CATCTGAGAGGGGCACCGCCAGG + Intergenic
1122367529 14:101202948-101202970 CATCAAAGTGGGGGCCTGCCAGG + Intergenic
1127060393 15:55176901-55176923 CATCTAACATGGGGCCTGCCTGG - Intergenic
1128868813 15:71136767-71136789 CCTCCAGGAGGGGGTCCTCCAGG + Intronic
1131180181 15:90234006-90234028 CTTTTAGGAGGGGGCGGGCCCGG - Exonic
1133306775 16:4814614-4814636 CATCCAGGAGGGGGCCCGTCTGG - Exonic
1134240847 16:12505191-12505213 CATCTAGGAGTGGAACTGCCAGG + Intronic
1137481290 16:48853787-48853809 CATCTTAGAGGGTGCCCACCAGG - Intergenic
1139717191 16:68822970-68822992 CATCTAGGAAGTGGCTCTCCAGG - Intronic
1142279713 16:89141525-89141547 CCTCTAGGCCGGGGCCCTCCAGG - Intronic
1143376040 17:6468296-6468318 CATCAAGGAAAGCGCCCGCCTGG - Exonic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1151390558 17:73784202-73784224 GAGCTGGGAGGGGGCCCACCAGG + Intergenic
1156467426 18:37356635-37356657 CATCAACGAAGGGGCCCTCCTGG + Intronic
1157620254 18:49013082-49013104 CTACTAGGAGGGGGCCCCCCAGG - Intergenic
1160692886 19:467884-467906 CATCTCGGAGGGGTCACCCCAGG + Intronic
1160823966 19:1070997-1071019 CAGCTAGGAGGGGACCCACATGG + Intronic
1161118132 19:2510958-2510980 CATCTAGGAGGGGCCGGGCGCGG - Intergenic
1162629700 19:11917433-11917455 TACCTAGGAGTGGGCCAGCCTGG + Intergenic
1164879102 19:31715688-31715710 CAGCCAGGAGGAGCCCCGCCAGG + Intergenic
1165361741 19:35341163-35341185 GATCTGGGAGGTGGCCCGGCTGG + Intronic
1167087568 19:47320671-47320693 CATCTACGTGGTGGCCGGCCAGG + Exonic
925314758 2:2912881-2912903 CATCAGGGAGGGGTCCCTCCTGG - Intergenic
925400999 2:3572804-3572826 TATCTAAGAGGGGCCCCTCCTGG + Intergenic
927256442 2:21044210-21044232 CCTCGGGGAGGGGGCCCACCTGG + Intergenic
929075761 2:38077368-38077390 CATGTAGGAAAGGGCGCGCCAGG - Intronic
933740483 2:85530142-85530164 CACCTAGGAGTGGGCCTGCTGGG + Intergenic
937145390 2:119639836-119639858 CATCTTGGAGGGGTCCGGCAGGG - Exonic
944539176 2:200740383-200740405 CAGCTAGGAAGGGGCAGGCCTGG - Intergenic
947445527 2:230159950-230159972 AATCTGGTAGGAGGCCCGCCTGG - Intergenic
948124693 2:235556137-235556159 CATGTGGGAGGGAGCCAGCCTGG + Intronic
948469317 2:238167140-238167162 CATGGAGGAGGAGGCCCACCCGG + Intronic
1172578310 20:36026611-36026633 CATCTAGCAGGCAACCCGCCTGG - Intronic
1174332343 20:49830342-49830364 CATCTAGGAGGGGGCCCGCCTGG + Intronic
1175511069 20:59526443-59526465 CATCCAGGTGGGGTCCAGCCTGG + Intergenic
1175789253 20:61731342-61731364 CATCTAGGAGGGTGGCGGTCAGG - Intronic
1176119783 20:63449066-63449088 CAACTAGGAGGAGGCAGGCCTGG + Intronic
1176124719 20:63470363-63470385 TATCTTAGAGGGGGCCCGTCCGG + Intronic
1180958974 22:19754197-19754219 CAGCCGGGAGGGGGCCGGCCAGG - Intergenic
1181756129 22:25026302-25026324 CATCTAGGTGGGGGCTGGCTGGG + Intronic
1184189521 22:42885592-42885614 CATCTGGGAGGGGAGCCGCATGG - Intronic
1184922703 22:47616588-47616610 AATCCAGAAGGGGGCCTGCCTGG - Intergenic
1185244288 22:49765113-49765135 CACCTGGGTGGGGGCCTGCCAGG - Intergenic
949245197 3:1918883-1918905 CATATAGGAGGGTGCCCCGCTGG - Intergenic
954717194 3:52532850-52532872 CTTCTTGGAGGGGGCCGGCTGGG - Intronic
961862487 3:129927728-129927750 GAGCTAGGAGATGGCCCGCCAGG + Intergenic
962951543 3:140224195-140224217 CAAATAGGAGGGGGCCAGGCTGG - Intronic
968235916 3:197029899-197029921 CCTCCAGCAGGGGGCGCGCCGGG - Intergenic
968447027 4:657292-657314 CACATGGGAGGGGGCGCGCCGGG + Intronic
969624501 4:8295421-8295443 CATCTGGGAGAGGCCTCGCCAGG + Intronic
985528756 5:421461-421483 CATCTGGGTGGGGTCCCGCGGGG + Intronic
997606174 5:135177162-135177184 CGCCTAGGAGGGAGCCCCCCAGG + Intronic
1001595985 5:172899016-172899038 CCTCTAGGAGGGGACCTGCTTGG + Intronic
1001640200 5:173238620-173238642 CATTTATCAGGGGGCCAGCCGGG - Intergenic
1002567335 5:180119328-180119350 CATCTGTGAGTGGGCCGGCCTGG - Exonic
1002577070 5:180180030-180180052 CAGCTAGGCGGGGGCAGGCCAGG + Intronic
1005480008 6:26246806-26246828 CATTTATGAGGAGACCCGCCGGG - Exonic
1007269320 6:40624174-40624196 CATGTAGTATGGGGTCCGCCGGG - Intergenic
1019762644 7:2825015-2825037 GATCTAGGAGGAGGCAAGCCAGG - Intronic
1019780828 7:2938699-2938721 CCTGCAGGAGGAGGCCCGCCAGG - Exonic
1022175659 7:27869639-27869661 CATCCAGGACGGGGCAGGCCAGG + Intronic
1032894996 7:136240685-136240707 CATCCAGGAGGGGGCCAGAGGGG + Intergenic
1034270613 7:149801982-149802004 CATGCAGGAGGGGGCCCTCAGGG - Intergenic
1035031464 7:155863735-155863757 CAGCTTGGAGGGGACCTGCCCGG + Intergenic
1035609200 8:948918-948940 CATCTTGGCGGGGGGACGCCAGG + Intergenic
1040551198 8:48438974-48438996 CATCTAGGAGGGCTCCCCGCTGG + Intergenic
1057488942 9:95507386-95507408 CACCCAGACGGGGGCCCGCCGGG - Intronic
1060596810 9:124853488-124853510 CGCCTAGGAGGGAGCCCGCCGGG + Exonic
1061423346 9:130484033-130484055 CACCCAGGATGGGGCCCGCCAGG + Intronic
1061677559 9:132226971-132226993 CAGGTAGGAGCCGGCCCGCCAGG - Exonic
1061847110 9:133394038-133394060 CATCTTGGTGGGTGCCCACCAGG - Intronic
1191875029 X:65787557-65787579 CAGATAGGAGGGTGCCCACCAGG - Intergenic
1199683113 X:150241045-150241067 CAGCTAGCAAGGGGCCCGCTGGG + Intergenic