ID: 1174332559

View in Genome Browser
Species Human (GRCh38)
Location 20:49831683-49831705
Sequence CCCGTGGGGCCCCCAAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174332548_1174332559 12 Left 1174332548 20:49831648-49831670 CCCAGATGAGCCAGACCAGACTC 0: 1
1: 0
2: 31
3: 44
4: 167
Right 1174332559 20:49831683-49831705 CCCGTGGGGCCCCCAAACTCAGG 0: 1
1: 0
2: 0
3: 12
4: 126
1174332553_1174332559 -3 Left 1174332553 20:49831663-49831685 CCAGACTCCAGACAGAGGGTCCC 0: 1
1: 0
2: 2
3: 23
4: 165
Right 1174332559 20:49831683-49831705 CCCGTGGGGCCCCCAAACTCAGG 0: 1
1: 0
2: 0
3: 12
4: 126
1174332549_1174332559 11 Left 1174332549 20:49831649-49831671 CCAGATGAGCCAGACCAGACTCC 0: 1
1: 0
2: 3
3: 17
4: 131
Right 1174332559 20:49831683-49831705 CCCGTGGGGCCCCCAAACTCAGG 0: 1
1: 0
2: 0
3: 12
4: 126
1174332550_1174332559 2 Left 1174332550 20:49831658-49831680 CCAGACCAGACTCCAGACAGAGG 0: 1
1: 0
2: 4
3: 17
4: 198
Right 1174332559 20:49831683-49831705 CCCGTGGGGCCCCCAAACTCAGG 0: 1
1: 0
2: 0
3: 12
4: 126
1174332557_1174332559 -10 Left 1174332557 20:49831670-49831692 CCAGACAGAGGGTCCCGTGGGGC 0: 1
1: 0
2: 1
3: 14
4: 124
Right 1174332559 20:49831683-49831705 CCCGTGGGGCCCCCAAACTCAGG 0: 1
1: 0
2: 0
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174332559 Original CRISPR CCCGTGGGGCCCCCAAACTC AGG Intronic
900719260 1:4164731-4164753 CCCTTGGGGCTCCCCAGCTCAGG + Intergenic
900933789 1:5752819-5752841 CCCGGGGGGCCCACGAACACAGG + Intergenic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
904483270 1:30807313-30807335 TCCGTGAGGCCCCCAGGCTCGGG - Intergenic
915269484 1:154743408-154743430 CCCCTGGGGCCCCCAACCTGGGG + Intronic
919742274 1:200988383-200988405 CCTGAGGAGCCCCCAAATTCAGG + Intronic
920121828 1:203664647-203664669 CCCGTGGGGCCCCTGCACCCGGG - Intronic
922384911 1:225073141-225073163 CCTGTGGGGCCTCCCAACTGGGG - Intronic
924883219 1:248186466-248186488 GCCGTGGAGCCACCAAGCTCTGG + Intergenic
1067542527 10:47166251-47166273 CCCCTAGGGCCCCCAGAATCCGG + Intergenic
1069717409 10:70529950-70529972 GCTGTGGGGCCCCCAACTTCCGG + Exonic
1074377783 10:112952713-112952735 GCCCTGGGGCCCCCAAAGTTGGG - Intronic
1075719070 10:124574592-124574614 CCCTCGGCGCCACCAAACTCAGG - Intronic
1076451769 10:130561322-130561344 CTCCTGGGGCCCCCATTCTCAGG + Intergenic
1076451848 10:130561637-130561659 CTCCTGGGGCCCCCATTCTCAGG + Intergenic
1076451874 10:130561733-130561755 CTCCTGGGGCCCCCATTCTCAGG + Intergenic
1077295965 11:1826448-1826470 CCTGTGGGGTCCCCACACTTAGG - Intergenic
1078363820 11:10690933-10690955 AGCTTGGGGCCCCCAGACTCTGG - Intronic
1080723822 11:34875051-34875073 GCTGTGGGGCAGCCAAACTCTGG + Intronic
1081990135 11:47333165-47333187 CACGTGGGGACCCCAGACCCTGG + Intronic
1085515547 11:77109779-77109801 CCCTTGGGGATCCCAGACTCTGG + Intronic
1089591875 11:119546879-119546901 CCAGTGGGGCCCCCACCTTCAGG + Intergenic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1094843588 12:34351941-34351963 CCCGTGGGGCCCAGTCACTCCGG + Intergenic
1096613378 12:52817557-52817579 CCTGTGGGGCACCCAAACCATGG + Intergenic
1097195215 12:57239233-57239255 GCCGAGCGGCCCCCAAGCTCGGG + Intronic
1103884651 12:124191418-124191440 CCCATGGAACCCCCAAACTAGGG + Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1106299892 13:28453937-28453959 CCCTAGGCACCCCCAAACTCGGG - Intronic
1109504967 13:63287793-63287815 CCAGTGGGGCTACCAGACTCTGG + Intergenic
1121437081 14:93927288-93927310 CCTGAGGGGCCCCCCAGCTCCGG + Intronic
1121595362 14:95157742-95157764 CCCGGGGGCCCCAAAAACTCCGG - Intronic
1122050776 14:99058298-99058320 CCAGTGAGGCTCCCATACTCTGG - Intergenic
1122226887 14:100285547-100285569 CTCGCGGGGACCCCACACTCAGG - Intergenic
1122327190 14:100889849-100889871 CCTGTCGGGCCTCCAAATTCTGG + Intergenic
1122370673 14:101227390-101227412 CCCGTGCGGCTCCCAAGCCCCGG + Intergenic
1122628169 14:103094765-103094787 CCCGTGGGGCCCTCAGAGCCGGG - Intergenic
1122767975 14:104084949-104084971 CCCGAGGGGCCCCCAAGGGCTGG - Intergenic
1125626750 15:41115694-41115716 CCCGTGGGGCGCCCACACGTGGG - Intronic
1125643528 15:41251458-41251480 CCCCTGGGGTCCCCAACCTCTGG + Intronic
1128562646 15:68678774-68678796 CCCCTGGGAGCCCCAAACTCAGG + Intronic
1129910333 15:79221361-79221383 GCCCTGAGGCCCTCAAACTCTGG + Intergenic
1130693267 15:86104676-86104698 CCCGTGGGGCTCCCAGAATGTGG + Intergenic
1130930783 15:88426029-88426051 CCCCTGGGAGCCCCAAACCCAGG + Intergenic
1132055364 15:98647830-98647852 CCCCCTGAGCCCCCAAACTCCGG + Intergenic
1132677033 16:1125110-1125132 CCTGTGGGGCCCCCATCCTCTGG + Intergenic
1132786242 16:1658401-1658423 TCCCTGGGGCACCCAAACACAGG - Intronic
1133707982 16:8373652-8373674 CCCTTATGGGCCCCAAACTCTGG + Intergenic
1136364228 16:29801623-29801645 CCTGTGAGGCCCCCAAGCTCTGG - Intronic
1138415678 16:56870131-56870153 CCGATGGAGCCCCCAAGCTCTGG - Exonic
1139698144 16:68689879-68689901 CCCGTAGTGCCCCCAATCACTGG - Intronic
1142212786 16:88816375-88816397 CTCCTGGGGCCCCGAGACTCAGG + Intronic
1143877536 17:10003455-10003477 CCCATGGGGTCCCCACAATCTGG + Intronic
1143899921 17:10166344-10166366 CCCTTGGGGCCCCCATCCCCTGG - Intronic
1144828788 17:18120796-18120818 CCCCCGCGGCCCCCAAGCTCCGG + Exonic
1144960644 17:19042295-19042317 GCTGTGGGCCCCCCAAACTCGGG - Intronic
1144974516 17:19132229-19132251 GCTGTGGGCCCCCCAAACTCGGG + Intronic
1147863080 17:43535072-43535094 CCTGCGGGGTTCCCAAACTCTGG + Intronic
1150441717 17:65196870-65196892 ACCGTGGGGAGCCCACACTCAGG - Intronic
1151484295 17:74388926-74388948 TCCGTGGGGCCCAGAAACTGCGG - Intergenic
1152127673 17:78457015-78457037 GCCCTGGGGCTCCCAAACACTGG + Intronic
1159860970 18:73648772-73648794 CCCCTGGGGCCCCCAGCCCCTGG + Intergenic
1161418153 19:4159515-4159537 GCCTTGGGGACTCCAAACTCTGG + Intronic
1165708922 19:37995796-37995818 CACGTGTGGGCCCCATACTCGGG - Intronic
1165862131 19:38914923-38914945 CCAGTGGGCATCCCAAACTCAGG - Intergenic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1167491996 19:49798422-49798444 CCAGAGGTGCCCCCAAACCCAGG - Intronic
1167521718 19:49959465-49959487 CCCCTGGGGCCCCAGAACCCTGG - Exonic
1167523665 19:49971257-49971279 CCCCTGGGGCCCCAGAACCCTGG + Intergenic
925332461 2:3069409-3069431 CCCGTGGGGCACCCAAGGACGGG - Intergenic
928198637 2:29232495-29232517 CCCCTGGAGCCCCTAAGCTCTGG + Intronic
928326903 2:30326518-30326540 CCTGTGTGGCCCCCAATCTGTGG - Intergenic
931837166 2:66111231-66111253 CCTCTGGGGCCCCCACACCCCGG + Intergenic
932023583 2:68112552-68112574 CCCGTGGTGCCCCCCACCTCAGG - Intergenic
938080596 2:128367973-128367995 CCCGTGGGCTTCCCAAACCCAGG - Intergenic
939149584 2:138456865-138456887 CCAGTGGGGCTGCCAGACTCTGG - Intergenic
945680861 2:212912546-212912568 CACGTGGGGCCAGCAAAATCAGG + Intergenic
946431567 2:219629380-219629402 CCTGTGGAGCCCCCCCACTCAGG + Exonic
948940136 2:241191291-241191313 CCCGTGGTGTCCCCACCCTCAGG - Intronic
1171119719 20:22557925-22557947 CCTGGGGGGTCCCCAAAGTCGGG + Intergenic
1171986101 20:31662206-31662228 CCCGAGAGCCCCCAAAACTCTGG - Intergenic
1172714265 20:36951353-36951375 CTCGTGGGGCCCCCTCCCTCAGG + Intronic
1172786922 20:37474567-37474589 CCTGGGGGGCCCCCAAATGCTGG + Intergenic
1173824277 20:46037293-46037315 CCCACGGCACCCCCAAACTCTGG - Exonic
1174332559 20:49831683-49831705 CCCGTGGGGCCCCCAAACTCAGG + Intronic
1179791258 21:43757241-43757263 CCTGGGGGGACCCCAAACTCTGG - Exonic
952342578 3:32458210-32458232 CCAGTGGGGCACAGAAACTCAGG - Intronic
966874580 3:184314891-184314913 CCCGCGGGGCCCGCATAGTCCGG - Intronic
968579032 4:1381163-1381185 CCTCTGGAGCCCCCAAACCCAGG - Intronic
968659270 4:1792534-1792556 CCCGTGGAGCCCAGAACCTCGGG + Intergenic
969624054 4:8293546-8293568 CCCCTGGGGACCTCACACTCAGG - Intronic
976907945 4:90263290-90263312 CCAGTGGGGCTGCCACACTCTGG + Intronic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
988676918 5:33441691-33441713 CCTGTGAGGCCCTCAAAGTCGGG - Intronic
994550694 5:101231393-101231415 CCAGTGGGGCTTCCACACTCTGG + Intergenic
997059021 5:130478683-130478705 CCAGTGGGGCTACCAGACTCTGG + Intergenic
1003216581 6:4118815-4118837 ACCGAGTGGCCTCCAAACTCAGG + Intronic
1003688748 6:8330812-8330834 CCTGAGGGGCCCCCACACTGTGG - Intergenic
1004286380 6:14324707-14324729 CCTGCGTGGTCCCCAAACTCAGG + Intergenic
1004402263 6:15299675-15299697 TCTGTGTGGCGCCCAAACTCTGG - Intronic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1005889523 6:30125592-30125614 CCCATGGGGCTTCCAGACTCTGG - Intergenic
1010015558 6:71101766-71101788 CCAGTGGGGCTACCAGACTCTGG + Intergenic
1013184983 6:107749693-107749715 CCTGTGGGGCCGCCAAGCTGGGG + Exonic
1015605756 6:134953268-134953290 CACCTGGGGCCCCCTAAATCAGG - Intergenic
1016797823 6:148136647-148136669 CCTGTGGGGTCCCCAAACTGTGG + Intergenic
1019478520 7:1255500-1255522 CCCGTGAGGCCCCCAAAGCCTGG + Intergenic
1021081483 7:16370473-16370495 CCAGTGGGGCTACCAGACTCTGG - Intronic
1027154894 7:75760020-75760042 CTCTTGGGGCCCCTCAACTCTGG - Intergenic
1027225993 7:76243988-76244010 CCTGTGTGGCCCTCAGACTCGGG - Intronic
1028283644 7:88966996-88967018 CCACTGTGACCCCCAAACTCTGG + Intronic
1029362891 7:100100363-100100385 CCCGTTGGCCCCTCACACTCCGG + Intronic
1032665531 7:134032570-134032592 CCAGTGAGGCCCCCCAGCTCAGG - Intronic
1035056865 7:156041620-156041642 CCCCTGGGCCCCCCAGACACAGG + Intergenic
1036744690 8:11397913-11397935 CCTGTGTGGCCAGCAAACTCAGG + Intronic
1036814158 8:11888662-11888684 CCACTGTGGCCCCCAGACTCTGG + Intergenic
1041823293 8:62063599-62063621 CTCTTGGGGTCCCCAAACCCAGG + Intergenic
1045316078 8:101044729-101044751 CCCGTGGGTCGCCCAGCCTCAGG - Intergenic
1048838438 8:138543803-138543825 CCCGAGTGCCTCCCAAACTCAGG + Intergenic
1049786572 8:144453810-144453832 CCTGGAGGGCTCCCAAACTCTGG - Intronic
1049867909 8:144950719-144950741 CCCCTGGGCCCCCCAACCACGGG + Intronic
1051809342 9:21031822-21031844 CCGGTGGGGTTACCAAACTCTGG + Intergenic
1054852599 9:69864026-69864048 CCTGGGGAGCCCTCAAACTCAGG - Intronic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1057261172 9:93585670-93585692 CCCCTGGGGCTGCCAGACTCAGG + Intronic
1058382469 9:104392514-104392536 CACATTGTGCCCCCAAACTCTGG - Intergenic
1059446208 9:114339627-114339649 ACCGTGGGGTCACCAAATTCTGG + Intronic
1059484893 9:114619009-114619031 CCCGTGGGCCCCCACAATTCTGG - Intronic
1061615205 9:131774709-131774731 GCCCTGGGGCCCCCAAACCCTGG - Intergenic
1061954591 9:133955231-133955253 CCTGTGGGGTCCCCAGAATCTGG - Intronic
1203759663 EBV:5597-5619 CCCGTGGGGTGCCCAAAGGCGGG - Intergenic
1203480097 Un_GL000224v1:4353-4375 CCCGTGAGGGCCCCACACCCAGG - Intergenic
1203416718 Un_KI270330v1:254-276 CCCGTGAGGGCCCCACACCCAGG + Intergenic
1188855406 X:35188378-35188400 CTCCTGGGGTCCACAAACTCTGG + Intergenic
1190284564 X:48953652-48953674 TCTGTGGGGTCTCCAAACTCAGG + Intronic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1196599420 X:117584816-117584838 CCAGTGGGGCTGCCACACTCTGG + Intergenic
1200048444 X:153415130-153415152 CTCATTGGGCCCCCACACTCTGG - Intergenic