ID: 1174338810

View in Genome Browser
Species Human (GRCh38)
Location 20:49883296-49883318
Sequence CAGGGACAGCATCTCGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174338807_1174338810 -10 Left 1174338807 20:49883283-49883305 CCAGGGGCCTCCACAGGGACAGC 0: 1
1: 0
2: 1
3: 37
4: 443
Right 1174338810 20:49883296-49883318 CAGGGACAGCATCTCGAGATAGG 0: 1
1: 0
2: 0
3: 6
4: 91
1174338801_1174338810 4 Left 1174338801 20:49883269-49883291 CCCCATCAGTGCCACCAGGGGCC 0: 1
1: 0
2: 1
3: 36
4: 223
Right 1174338810 20:49883296-49883318 CAGGGACAGCATCTCGAGATAGG 0: 1
1: 0
2: 0
3: 6
4: 91
1174338795_1174338810 20 Left 1174338795 20:49883253-49883275 CCTAAGCAGCCCACAGCCCCATC 0: 1
1: 0
2: 1
3: 33
4: 343
Right 1174338810 20:49883296-49883318 CAGGGACAGCATCTCGAGATAGG 0: 1
1: 0
2: 0
3: 6
4: 91
1174338796_1174338810 11 Left 1174338796 20:49883262-49883284 CCCACAGCCCCATCAGTGCCACC 0: 1
1: 0
2: 1
3: 26
4: 377
Right 1174338810 20:49883296-49883318 CAGGGACAGCATCTCGAGATAGG 0: 1
1: 0
2: 0
3: 6
4: 91
1174338803_1174338810 2 Left 1174338803 20:49883271-49883293 CCATCAGTGCCACCAGGGGCCTC 0: 1
1: 0
2: 2
3: 26
4: 254
Right 1174338810 20:49883296-49883318 CAGGGACAGCATCTCGAGATAGG 0: 1
1: 0
2: 0
3: 6
4: 91
1174338794_1174338810 23 Left 1174338794 20:49883250-49883272 CCACCTAAGCAGCCCACAGCCCC 0: 1
1: 0
2: 2
3: 24
4: 321
Right 1174338810 20:49883296-49883318 CAGGGACAGCATCTCGAGATAGG 0: 1
1: 0
2: 0
3: 6
4: 91
1174338797_1174338810 10 Left 1174338797 20:49883263-49883285 CCACAGCCCCATCAGTGCCACCA 0: 1
1: 0
2: 5
3: 46
4: 453
Right 1174338810 20:49883296-49883318 CAGGGACAGCATCTCGAGATAGG 0: 1
1: 0
2: 0
3: 6
4: 91
1174338802_1174338810 3 Left 1174338802 20:49883270-49883292 CCCATCAGTGCCACCAGGGGCCT 0: 1
1: 0
2: 0
3: 9
4: 161
Right 1174338810 20:49883296-49883318 CAGGGACAGCATCTCGAGATAGG 0: 1
1: 0
2: 0
3: 6
4: 91
1174338806_1174338810 -7 Left 1174338806 20:49883280-49883302 CCACCAGGGGCCTCCACAGGGAC 0: 1
1: 0
2: 2
3: 40
4: 286
Right 1174338810 20:49883296-49883318 CAGGGACAGCATCTCGAGATAGG 0: 1
1: 0
2: 0
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174338810 Original CRISPR CAGGGACAGCATCTCGAGAT AGG Intronic
900611166 1:3545191-3545213 CAGGGACACCAGCCCGAGAGGGG + Intronic
905020350 1:34806600-34806622 CAGTGACAGCATCATCAGATAGG + Intronic
905876448 1:41434757-41434779 CAGGCACAGCATCTCTAGAGAGG + Intergenic
915457464 1:156050438-156050460 CTGTGACAGCATCTCAGGATTGG + Exonic
916239523 1:162625004-162625026 CAGGAAGAGCATCTCGACCTTGG + Intergenic
923471883 1:234298639-234298661 CTGAAACAGCATCTCTAGATTGG + Intronic
924443062 1:244102827-244102849 CTGGGTCAGCATCTTGGGATGGG - Intergenic
924665662 1:246069091-246069113 CAGCTACAGCATCTCAAAATTGG - Intronic
1064319525 10:14290644-14290666 AAGGAACAGCATCATGAGATTGG + Intronic
1066226689 10:33390134-33390156 CAGGCACAGAATCTGGAGACAGG + Intergenic
1067152944 10:43751564-43751586 CAGGAGCAGCATCTCCGGATCGG + Intergenic
1069572242 10:69501267-69501289 CACGGACATCATCTGCAGATAGG + Intronic
1070733920 10:78850734-78850756 CAGGGTCTGCATCTCCAGGTTGG + Intergenic
1074904969 10:117853396-117853418 CAAGGACATCTTATCGAGATGGG + Intergenic
1075668133 10:124245109-124245131 CAGGGACCGCATGTCCTGATGGG - Intergenic
1075727514 10:124618133-124618155 CAGGGACCTCATCTAGGGATTGG + Exonic
1076468634 10:130703084-130703106 CAGGGACAGCATCTGAAGTCTGG - Intergenic
1076852664 10:133100655-133100677 TCAGGACAGCATCTGGAGATAGG - Intronic
1083678707 11:64341666-64341688 CCGGGACAGCATCTCCAGCTCGG - Exonic
1088844151 11:113650834-113650856 CAGGGACAGCACTTTGAGAATGG + Intergenic
1093901504 12:24639698-24639720 CAGGGAAAGGCTCTAGAGATAGG + Intergenic
1095592932 12:43925097-43925119 CAGAGACAGCAACTCGAGAGAGG + Intronic
1096587720 12:52633919-52633941 CAGGGCCAGTTTCTAGAGATAGG + Intergenic
1096967883 12:55643107-55643129 CACTGACAGCATCTGGAGAGAGG + Intergenic
1109498248 13:63203910-63203932 CAGGGAATGCATCCTGAGATGGG + Intergenic
1112644509 13:101314179-101314201 GAGGGATAGCATTTGGAGATAGG + Intronic
1120246554 14:82012618-82012640 AAGTGACAGCTTCTCTAGATGGG + Intergenic
1121403402 14:93702820-93702842 CAGGGACAGTTTCTGGGGATGGG - Intronic
1124206398 15:27724487-27724509 AAGGGACAGTATTTGGAGATAGG - Intergenic
1128957199 15:71960764-71960786 CAGGGACAGCCTCTCCAAAGAGG + Intronic
1130041131 15:80405581-80405603 CAGGGAAGGCTTCTGGAGATTGG + Intronic
1131398598 15:92106567-92106589 CAGGGTCATCATCCCGAGGTGGG - Intronic
1136924903 16:34362812-34362834 CAGGAAGAGCATCTCTAGAGAGG - Intergenic
1136979670 16:35048994-35049016 CAGGAAGAGCATCTCTAGAGAGG + Intergenic
1139058304 16:63215876-63215898 CAGTGGCACTATCTCGAGATCGG + Intergenic
1142118416 16:88373372-88373394 GAGAGACAGCATCTCAGGATGGG + Intergenic
1143036324 17:4001347-4001369 CTGGGACAGCGCCTCCAGATAGG + Intergenic
1149525771 17:57354609-57354631 CAGAGGCAACATCTTGAGATAGG + Intronic
1151652751 17:75480343-75480365 CAGGGACACCAGCTCCAGACTGG - Intronic
1152107149 17:78337295-78337317 CAGAGCCAGCCTCCCGAGATGGG - Intergenic
1158944621 18:62437721-62437743 CAGGGACAGCAAATCGAATTTGG - Intergenic
1159362236 18:67420205-67420227 CAAGGACAGCATCAAGAGAATGG + Intergenic
1159945105 18:74438897-74438919 CAGGGGCAGCATCTAGTGATTGG - Intronic
1162640209 19:12002608-12002630 CAGGGTCAGGAGATCGAGATTGG - Intergenic
1164476535 19:28579832-28579854 CAGGGACAGCAGCTCTCCATGGG - Intergenic
1164974641 19:32563222-32563244 CAAGGTCAGCAGTTCGAGATCGG + Intergenic
1167988333 19:53337177-53337199 CAGGGACAGCAACCTGAGACAGG - Intronic
1168001009 19:53446012-53446034 CAGGGACAGCAACCTGAGACAGG - Intronic
925634137 2:5926067-5926089 CACGCACAGCAGCTCAAGATGGG + Intergenic
928364899 2:30692842-30692864 CAGGTAAAGGATCTTGAGATGGG + Intergenic
930770193 2:55122802-55122824 CAGGGACAGGCTCTGGGGATGGG - Intergenic
932016035 2:68027114-68027136 CAAGGCCAGGATCTAGAGATGGG - Intergenic
939663220 2:144916801-144916823 CTGGGAAACCATCTCGAGGTGGG + Intergenic
946439416 2:219682357-219682379 CAGGGACAGCATCTCCACAGTGG - Intergenic
947467165 2:230361545-230361567 CAGGGACAACACCTGGAAATTGG - Intronic
948948167 2:241232151-241232173 CAGGTACAGAACCTCAAGATCGG + Intronic
1168848623 20:961633-961655 GTAGGACAGCATCTGGAGATGGG + Intronic
1172229661 20:33328223-33328245 CAGGGAGGGCTTCTCGAGGTGGG + Intergenic
1173656304 20:44702710-44702732 AAGGGACATCATCTCGGGAGAGG - Intergenic
1174338810 20:49883296-49883318 CAGGGACAGCATCTCGAGATAGG + Intronic
1177294713 21:19159933-19159955 AAGTGCCAGCATCTCCAGATGGG - Intergenic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1179517651 21:41919862-41919884 CAGGGAGAGGACCTCAAGATGGG + Intronic
950047780 3:9960518-9960540 CAGGGACAGCACCTCCTGTTGGG + Intergenic
958931265 3:100210477-100210499 CAGGGAAAGCATGTCCAGAGAGG - Intergenic
962478700 3:135780027-135780049 CAGGGACAGCTTTTTGAGGTAGG - Intergenic
963930720 3:151001674-151001696 GAGGGAGAGCATATGGAGATGGG - Intergenic
970311661 4:14788322-14788344 AAGTGCCAGCATCTCCAGATGGG + Intergenic
971226774 4:24761337-24761359 CAGAGACCACATCTTGAGATTGG + Intergenic
972193042 4:36617886-36617908 CAGGGACACGATCTCCAGTTAGG - Intergenic
976386165 4:84461182-84461204 AGGGGACAGGATCTTGAGATAGG - Intergenic
978691084 4:111511377-111511399 CAGCGACAGCATCTTTAGGTTGG - Intergenic
979134229 4:117088721-117088743 CAGGGACAGCCTCTCTAAATAGG + Intergenic
996524481 5:124463500-124463522 TAGGGACAGCATACTGAGATTGG - Intergenic
996790078 5:127282936-127282958 CAGGGACAGCCTGACCAGATTGG + Intergenic
1000148723 5:158479106-158479128 CAAGGCCAGCATCTCCAGAGAGG - Intergenic
1001059582 5:168477133-168477155 CCGGGACGGCATCTGGAGGTGGG + Intergenic
1001840192 5:174869380-174869402 AAGGAACAGAATCTCGAAATGGG + Intergenic
1008980888 6:57482738-57482760 TAGGGACAGCATCAAGAGACAGG + Intronic
1014858188 6:126429407-126429429 CAGGGACAGCACCAAGGGATGGG - Intergenic
1018273932 6:162109714-162109736 AAGGGACAGCATCTGTAGAGAGG - Intronic
1019509869 7:1412473-1412495 CAGGGACAGCATCTGTAGTCAGG - Intergenic
1037750086 8:21675979-21676001 CAGGGACGGCATCTAGAAGTTGG - Intergenic
1037877486 8:22555058-22555080 GAGGGGCAGCAGCTGGAGATGGG + Intronic
1045292027 8:100841945-100841967 CAGGGACAGGTCCTCCAGATAGG - Intergenic
1048283522 8:133123252-133123274 CAGGGACAGCATCTTGGCAGGGG - Intronic
1048885118 8:138903531-138903553 CAGAAACAGCATCTGGAGGTAGG + Intronic
1055236970 9:74133878-74133900 CAGGGACTACATCTGGACATCGG - Intergenic
1056474614 9:86941813-86941835 CAGGGACCCCATCTGGAGAATGG + Intergenic
1186393022 X:9180254-9180276 TAGGGACAGGACCTAGAGATGGG + Intergenic
1186543060 X:10420514-10420536 CAAGTACAGCTTCTCAAGATGGG - Intergenic
1189491457 X:41474286-41474308 CAGGTAGAGCAGCTCGAGCTCGG - Exonic
1192292801 X:69815412-69815434 CTGGGACAGCTTCTGGAGTTGGG + Intronic
1193818695 X:86135314-86135336 CAGGGAAGGCTTCTCAAGATAGG - Intergenic
1195858146 X:109352695-109352717 CATGGACAGCAGCTCCAGAGTGG + Intergenic
1195986753 X:110638765-110638787 CAGGGACAGCAGCAAGACATTGG + Intergenic
1196458521 X:115906522-115906544 CAGGGACAGGATCTTGAGGGAGG - Intergenic
1196993767 X:121358147-121358169 CAGGGAAAGCTTCTTGACATTGG - Intergenic