ID: 1174340051

View in Genome Browser
Species Human (GRCh38)
Location 20:49889946-49889968
Sequence CCTGGTGACGAGGGGGCAGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174340051_1174340059 6 Left 1174340051 20:49889946-49889968 CCGTCTGCCCCCTCGTCACCAGG 0: 1
1: 0
2: 1
3: 28
4: 259
Right 1174340059 20:49889975-49889997 AGCCCCAGCCAGGTCACACCTGG 0: 1
1: 0
2: 1
3: 31
4: 291
1174340051_1174340058 -4 Left 1174340051 20:49889946-49889968 CCGTCTGCCCCCTCGTCACCAGG 0: 1
1: 0
2: 1
3: 28
4: 259
Right 1174340058 20:49889965-49889987 CAGGTGTGATAGCCCCAGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174340051 Original CRISPR CCTGGTGACGAGGGGGCAGA CGG (reversed) Exonic
900623942 1:3599684-3599706 CCGGCTGGCGAGGTGGCAGATGG + Intronic
902082328 1:13829444-13829466 GCTGGTGGGGAGGGGGCAGGGGG + Intergenic
902614349 1:17615794-17615816 CCTGGTGAGGAGGGGGCCGAGGG - Intronic
903215671 1:21842142-21842164 CCTGGGGCCAAAGGGGCAGAGGG + Exonic
903350398 1:22713202-22713224 CCTAGTGTCCAGGGGGCAAACGG - Intronic
905202166 1:36322643-36322665 GCTGATGACGAGCAGGCAGAGGG + Exonic
905242386 1:36589238-36589260 CCTGGAGAGGAAGGGGGAGAGGG + Intergenic
905744261 1:40400557-40400579 CTTGGTGATGTGGGGGCTGAAGG + Intronic
905888108 1:41502567-41502589 GCAGGTGAAGAGGGTGCAGATGG - Intergenic
906279603 1:44544071-44544093 CCTGGGGATGAGGAGGAAGATGG - Intronic
906519492 1:46458813-46458835 CCAGGTGAGGACGGGGCAGAGGG - Intergenic
906732920 1:48098659-48098681 TCTGGTGCCGAAGGAGCAGAAGG - Intergenic
907427645 1:54390957-54390979 GCCGGTGCTGAGGGGGCAGATGG - Intronic
907905814 1:58783226-58783248 GCTGGTGAGGAGGGCGCAGCGGG - Exonic
909433399 1:75615338-75615360 CCTAGGGACGAAGGGGCGGAGGG + Intergenic
915310032 1:155002110-155002132 CCTGGAGAGGAGGGGGGAGGGGG - Intergenic
917289671 1:173460100-173460122 CCTGGTGATGTGGGTGCACAAGG - Intergenic
917969337 1:180197042-180197064 CCTGGGGAGGAGGCGGGAGAGGG + Exonic
920264649 1:204712538-204712560 CCCGGGGACGGGGAGGCAGATGG + Intergenic
920299587 1:204980384-204980406 CCTGGTGACGTGAAGGGAGAGGG + Exonic
920388091 1:205581990-205582012 ACTGGTGATGAGGGGGCAGCAGG - Intronic
921362222 1:214340820-214340842 CCTGGTGAAACTGGGGCAGAGGG - Intergenic
922534280 1:226368321-226368343 CCTGGAGAGGAGGGGACAGAAGG + Exonic
922555646 1:226530162-226530184 CCTCGTGAAGCGGGGACAGAGGG + Intergenic
922740294 1:228010608-228010630 GCTGGTGACGGCCGGGCAGAAGG - Intronic
923102348 1:230826564-230826586 GCTGGAGGTGAGGGGGCAGAAGG - Intergenic
923689685 1:236179857-236179879 CCTGGAAAAGAGGGAGCAGAAGG - Exonic
1064213540 10:13380966-13380988 CCAGGTGTGGTGGGGGCAGAAGG + Intergenic
1066438037 10:35412181-35412203 TCCTGTGACTAGGGGGCAGAGGG + Intronic
1066455431 10:35568022-35568044 GCTGGTGACGAGGGGGACCAGGG - Intronic
1067289619 10:44931687-44931709 CCTGGTGACCAGCAGGTAGAAGG + Intronic
1069635007 10:69919706-69919728 GCTGGGAAAGAGGGGGCAGAGGG + Intronic
1069751282 10:70746837-70746859 CCCGGTGGCAAGTGGGCAGAAGG + Intronic
1069987498 10:72294373-72294395 CCTGGTGTCCTGGGGACAGAGGG - Intergenic
1070149451 10:73797011-73797033 CCTGGTGAGGTGGGGGCACTGGG + Exonic
1071524226 10:86348945-86348967 CCTGGTGAGCAGGGGCTAGAAGG - Intronic
1072336575 10:94403142-94403164 CCTGGCGACGAGGACGCGGACGG + Exonic
1073098185 10:100993168-100993190 CCTGGGGAACAGGGGGCAGAAGG - Exonic
1074919318 10:117991355-117991377 CCTGATGAGGAAGGGGCAGAGGG + Intergenic
1074963879 10:118471919-118471941 CCTGATGACCAGGGGCCAGTGGG + Intergenic
1076228190 10:128797832-128797854 TCTGGAGAAGAGGGGGCAGCAGG + Intergenic
1076305099 10:129460804-129460826 CCTGGTGAGGAGGGGGCTGGGGG - Intergenic
1076692951 10:132233078-132233100 CCTGGGGACGTGGGGACAGCAGG + Intronic
1076756863 10:132577117-132577139 CCAGGAGTGGAGGGGGCAGAGGG + Intronic
1077411929 11:2407705-2407727 CCTGGAGCGGAGGGAGCAGAGGG - Intronic
1078933448 11:15930735-15930757 CCTGAAGACGAAGGAGCAGAAGG - Intergenic
1081525568 11:43925323-43925345 CCTGGTGACAAGAGGGAACATGG + Exonic
1081535964 11:43996430-43996452 CTTGGTGAGGATGGGGCAGATGG + Intergenic
1083800753 11:65045068-65045090 CCTGGTGCTTAGGTGGCAGAGGG - Exonic
1086110648 11:83194548-83194570 CCTAGTGACGACGGAGAAGAGGG + Exonic
1089289546 11:117429372-117429394 CCTGGAGAAGAGGGGACCGAGGG - Intronic
1089446518 11:118557138-118557160 TCTGGTGACGAGGTGCCAGGTGG - Intronic
1091342007 11:134823311-134823333 CCCAGGGACAAGGGGGCAGAGGG + Intergenic
1096572004 12:52528888-52528910 CCTGGGGATGAGGAGGCTGATGG - Intergenic
1097052196 12:56230357-56230379 CCTGGGGAGGAGGGGGGAAAAGG - Intronic
1097270625 12:57771955-57771977 GCTAGTGAGGAGTGGGCAGAGGG - Exonic
1097498392 12:60373008-60373030 CCTGGTGACGTGGGCTCACAAGG - Intergenic
1099988650 12:89699070-89699092 CATGGTGAAGAGGGGACAGGGGG - Intronic
1100291141 12:93215894-93215916 CCTGCTAATGAGGGGGCAAAAGG - Intergenic
1100684398 12:96970899-96970921 CCTGGTGAAGAGGGAGAGGAAGG + Intergenic
1101902815 12:108803723-108803745 CCTGGTGAGAAGGGAACAGAAGG - Intronic
1102116903 12:110409749-110409771 CCTGGGGAGGAGAGGTCAGATGG + Intergenic
1102244716 12:111348056-111348078 CCTGGTGAGGAGGCGGCCGAGGG - Exonic
1102774697 12:115508327-115508349 CTCAGTGACGAGAGGGCAGAGGG - Intergenic
1103920871 12:124398562-124398584 CCTGGTGACGTGGCGACAGTGGG + Intronic
1104895190 12:132160539-132160561 CCTGGAAACCAGGGGACAGAGGG + Intergenic
1106132616 13:26952479-26952501 CCTGGAGAGAAGGGGCCAGATGG + Intergenic
1106583062 13:31034125-31034147 CCTGGTGTTTAGAGGGCAGAAGG - Intergenic
1107836741 13:44417712-44417734 CCTGTTGATGGTGGGGCAGAGGG + Intergenic
1107965851 13:45597618-45597640 CCTGGTGAGCTGAGGGCAGATGG - Intronic
1110371304 13:74743559-74743581 CCTGGGGACCAGGGGGAAGTGGG - Intergenic
1112176123 13:97026805-97026827 CCTGTTGGCGAGAGGTCAGAAGG + Intergenic
1113896654 13:113768748-113768770 CCTGGAGAAGACGGGACAGATGG + Intronic
1114227583 14:20753043-20753065 CGTGATGAAGAGGGAGCAGAAGG - Intergenic
1116351349 14:43867769-43867791 CTTGGAGAAGAGGGAGCAGATGG - Intergenic
1117322026 14:54633575-54633597 CCTGGTGCCTAGGGGGTAGTGGG + Intronic
1118451001 14:65902044-65902066 CTTGGTGAGGAGGAGGCAGAGGG + Intergenic
1121304362 14:92896865-92896887 CCTGGGGGCCAGGAGGCAGAAGG + Intergenic
1122267335 14:100552835-100552857 CCTGGTGACTGCTGGGCAGACGG + Intronic
1122294821 14:100699455-100699477 CCTGGTGGCCAGTGGGAAGAGGG + Intergenic
1122652414 14:103232757-103232779 CTTGGTGAGGCTGGGGCAGATGG + Intergenic
1122972592 14:105158463-105158485 CCAGGTGGCCCGGGGGCAGAGGG - Intronic
1123024787 14:105419616-105419638 CCTGGTGCCCTGGGGGTAGAGGG - Intronic
1123402527 15:20002802-20002824 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123511865 15:21009456-21009478 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123996650 15:25722814-25722836 CCAGAGGACGAGGGGGCAGTGGG - Intronic
1124170683 15:27369933-27369955 GCTGGTGAGTAAGGGGCAGAAGG - Intronic
1124216648 15:27812979-27813001 CCTCCTGGGGAGGGGGCAGAAGG - Intronic
1124256258 15:28145189-28145211 CCAGGTGACCAGGCAGCAGAAGG + Intronic
1124614880 15:31234308-31234330 CTTGCTGAGGAAGGGGCAGAAGG + Intergenic
1124708569 15:31985778-31985800 CCTGGGACAGAGGGGGCAGATGG + Intergenic
1128135615 15:65261109-65261131 CCTGGTGCTGAGGGGGAAGAAGG + Intronic
1129248595 15:74295591-74295613 CCCGGTGAGCAAGGGGCAGATGG + Intronic
1129614097 15:77084255-77084277 CCTAGACACGAGGGAGCAGATGG + Intergenic
1129788236 15:78323113-78323135 CCTGGGGATGAGGGGGAAGGAGG + Intergenic
1132601403 16:774686-774708 CCTGCGGCCGAGGGGGCAGAGGG - Intronic
1132618943 16:855391-855413 CCTGGTCACCAGGGGTCAGGCGG - Intronic
1132626472 16:894029-894051 ACAGGGGACGAGTGGGCAGACGG - Intronic
1133264479 16:4575152-4575174 CCTGCAGAAGAGGGGGCAGAGGG - Exonic
1135168901 16:20165653-20165675 CCTGGTGGGGAGGTGGGAGAAGG + Intergenic
1138134678 16:54511511-54511533 CCTGGAGACAAGGTAGCAGAGGG + Intergenic
1140123863 16:72104736-72104758 CCTGGGGACCATGGGGCAAATGG + Intronic
1140257035 16:73346324-73346346 CATGGTGGCGAGAGGACAGACGG - Intergenic
1140596876 16:76426128-76426150 ACTGGTGGAGTGGGGGCAGAAGG + Intronic
1141503618 16:84461086-84461108 CCTGGTGACAAGGGAACAGGGGG - Intronic
1141799710 16:86298490-86298512 CCTGGTGAGGAAAGGGCAGATGG - Intergenic
1142211724 16:88811674-88811696 CCTGGTGACGCCGGGGCCGAAGG + Intronic
1142237146 16:88927704-88927726 CCTGGGGAGGAGGAGGCGGAAGG - Intronic
1142353141 16:89588880-89588902 CCTGGAGACCAGGGGGGTGAGGG - Intronic
1142576666 17:913594-913616 CCTGGGGACGTGGGGGTAGGTGG - Intronic
1142576682 17:913655-913677 CCTGGGGACGTGGGGGTAGGTGG - Intronic
1143477542 17:7211403-7211425 TCTGGTGAGGAGGGGGCCAAAGG - Intronic
1144502658 17:15802695-15802717 CCTGGTGGGGAGGAGGCAGGAGG + Intergenic
1144512396 17:15888287-15888309 GCTGGTGACCAAGGAGCAGATGG - Intergenic
1144778304 17:17795799-17795821 CCAGGTGAAGAGGGGCCTGATGG + Exonic
1145164838 17:20605349-20605371 CCTGGTGGGGAGGAGGCAGGAGG + Intergenic
1146905186 17:36613527-36613549 CCTGGGGAAGGGGAGGCAGAGGG - Intergenic
1146912159 17:36655706-36655728 CCTGGTGGGGTGGGGGCAGCTGG + Intergenic
1148088669 17:45009622-45009644 CATGGTGAGGGGTGGGCAGAGGG - Intergenic
1148466142 17:47866390-47866412 CCTGGAGACAAGGAGGAAGATGG + Intergenic
1148905238 17:50907817-50907839 CCTGGTGAGGACTGGGCTGAGGG - Intergenic
1149990501 17:61380644-61380666 CCTGGGCACGAGGGGGTAGGAGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150644886 17:66971758-66971780 CCTGGTGAGGATGGAGGAGAGGG + Intronic
1151460559 17:74251881-74251903 CCTTGAGAAGAGGGGGCAAAGGG - Intronic
1151518241 17:74611221-74611243 CATGGTGACTAGGGGAAAGATGG - Exonic
1152416931 17:80168760-80168782 CCTGGTGATGAGCCGGCTGAAGG - Intergenic
1152556899 17:81057915-81057937 CCTGGTGAAGATGGGGGAGCTGG + Exonic
1152604423 17:81282000-81282022 CCTGGGCACCATGGGGCAGACGG - Intronic
1154033965 18:10780362-10780384 CATGGCTACGAGGTGGCAGACGG + Intronic
1154194990 18:12258946-12258968 CCTGGTGACCCGGGGGGAGAGGG - Intronic
1155018140 18:21866567-21866589 CCTGGTGAGGAGGGAGCACCTGG + Exonic
1157626497 18:49055313-49055335 CCTAGAGTCGAGGGGACAGATGG + Intronic
1160169761 18:76543463-76543485 GCTGGTGAGGAGGTGCCAGAAGG + Intergenic
1160374095 18:78397908-78397930 CCTGAAGAAGAGAGGGCAGAAGG + Intergenic
1160495515 18:79372183-79372205 GCAGGGGACGAGGGGGCAGGAGG - Intronic
1160495524 18:79372205-79372227 GCAGGGGACGAGGGGGCAGGAGG - Intronic
1160495533 18:79372227-79372249 GCAGGGGACGAGGGGGCAGGAGG - Intronic
1160495542 18:79372249-79372271 GCAGGTGACGAGGGGGCAGGAGG - Intronic
1160913197 19:1484119-1484141 CGTGGTGACCTGAGGGCAGAGGG + Exonic
1162404868 19:10467586-10467608 CCTGGTGGCGGGGGGTCAGGTGG + Exonic
1162705350 19:12551172-12551194 CCTGCGGCCGAGGGGACAGAGGG + Intronic
1162824252 19:13241926-13241948 CCTGGGGTTTAGGGGGCAGAGGG - Intronic
1162837446 19:13330167-13330189 CATGGTGGGGTGGGGGCAGAGGG - Intronic
1163800477 19:19362002-19362024 ACTGGTGGGGATGGGGCAGAAGG - Intergenic
1164324242 19:24178390-24178412 ACTGGCGTCGAGGGGGCAGCGGG - Intergenic
1164941198 19:32253251-32253273 CCTGGTGACCAGGGAAGAGAAGG - Intergenic
1165058864 19:33195159-33195181 CCTGGAGACGAGGGGGCCCCGGG + Intronic
1166230750 19:41424819-41424841 ACAGGTGAAGAGGGGGCTGACGG - Exonic
1166774202 19:45302664-45302686 GCGGGTGACGAGGGTGCGGAAGG - Exonic
1167015552 19:46838710-46838732 CCTGGTGAAGAGGAGGCTGAAGG - Intronic
1167285952 19:48599113-48599135 CCTGGAGAAGAGGGGGCACCAGG - Exonic
1167293766 19:48637820-48637842 CCTGATGGCGAGGGGGGTGATGG + Intergenic
1167793052 19:51692532-51692554 CCTGATGAGGAAGGGGCTGAGGG + Intergenic
1168288951 19:55347731-55347753 CCTGGGGAGGAAGGGGCTGAGGG - Exonic
925429450 2:3778480-3778502 TCTGCTGACCAGGGAGCAGAGGG + Intronic
926002631 2:9346091-9346113 CCTGGGGTCGCGGGGGCAGGGGG - Intronic
926037622 2:9647577-9647599 CTTGGTGACAAGGGGGAATAAGG - Intergenic
926222868 2:10947721-10947743 CCTGGGGAGGAGTGGGCAGCGGG + Intergenic
928132515 2:28662997-28663019 CCTGGTGACGAGACTGCGGAGGG + Intergenic
929806716 2:45152882-45152904 CATTGTGGGGAGGGGGCAGAAGG + Intergenic
930808892 2:55520058-55520080 CCTGATGACGCGGGTGGAGAAGG - Intronic
930825480 2:55693169-55693191 CCTGGTGAAGAGGAGGCTGAAGG + Intronic
930962395 2:57277031-57277053 CCTGCTGACGAGGTCACAGATGG + Intergenic
933200090 2:79438138-79438160 CATGGAGACGCGGAGGCAGAAGG + Intronic
933994412 2:87657229-87657251 CATGGTGAGAAGGAGGCAGAAGG + Intergenic
936299446 2:111293684-111293706 CATGGTGAGAAGGAGGCAGAAGG - Intergenic
936539935 2:113341634-113341656 CATGGTTCCCAGGGGGCAGAGGG + Intergenic
938422618 2:131156596-131156618 CCCTGTGAGGTGGGGGCAGAAGG + Intronic
948456692 2:238107769-238107791 CCTGGGGAAGGAGGGGCAGAGGG - Exonic
948494316 2:238337029-238337051 CAGGGTGGAGAGGGGGCAGAGGG + Intronic
948858296 2:240740828-240740850 CCTGGTGCCCTGGGGGCAGCTGG - Intronic
1170710910 20:18789835-18789857 ACTGGTGAAGAGGTGGGAGAAGG - Intergenic
1170727877 20:18946187-18946209 CCTGATGACACAGGGGCAGACGG + Intergenic
1172010343 20:31842805-31842827 CATGGTGAGGAGGGGGAAGGAGG - Intergenic
1172884612 20:38222752-38222774 CGTGGTGACGAGAGGGGACATGG - Intronic
1172925026 20:38526097-38526119 CCTGCTGAGGAGGCGGCAGTCGG + Intronic
1173801090 20:45894925-45894947 CCTGGTGAGGTGGGGGCAGGGGG + Intronic
1173925576 20:46778776-46778798 CCTGGTGCAGAGGAGGAAGAGGG - Intergenic
1174340051 20:49889946-49889968 CCTGGTGACGAGGGGGCAGACGG - Exonic
1175440466 20:58987376-58987398 CCCAGTGAGGAGGGAGCAGATGG - Intronic
1176138596 20:63535782-63535804 CCAGGTGAGGAGGGGGCGGGAGG - Intronic
1176138606 20:63535805-63535827 CCAGGTGAGGAGGGGGCGGGAGG - Intronic
1176138629 20:63535852-63535874 CCAGGTGAGGAGGGGGCGGGAGG - Intronic
1176138639 20:63535875-63535897 CCAGGTGAGGAGGGGGCGGGAGG - Intronic
1176138692 20:63535990-63536012 CCAGGTGAGGAGGGGGCGGGAGG - Intronic
1178501327 21:33127962-33127984 CCTGCTGATGAGAGGGCACAGGG + Intergenic
1178944363 21:36933929-36933951 CCTGGAGACAAGGGGGAAGATGG + Intronic
1180139115 21:45880659-45880681 CCTGGCACCGAGAGGGCAGAGGG - Intronic
1180149462 21:45940318-45940340 CCTGGAGCAGAGGGGACAGAAGG - Intronic
1182765009 22:32752449-32752471 CCTTGTGCTGAGGGGGCTGAAGG - Intronic
1185085163 22:48737037-48737059 CCTGGGGACCAGGGGAGAGACGG - Intronic
1185113697 22:48919303-48919325 CCTCCTGACGAGGGTGCAGCGGG + Intergenic
1185139469 22:49092292-49092314 CCTGGTGACGTGGGGGTGGAGGG + Intergenic
950428986 3:12940226-12940248 CCAGGTGAGGAAGGGGCTGATGG + Intronic
951006969 3:17628460-17628482 CATGGTGAAGTGGGGGGAGAGGG - Intronic
952985055 3:38771533-38771555 CAAGGTGATGAGGGGGAAGAAGG + Intronic
954132791 3:48568818-48568840 CCTGGTGACAAGGGCTCAGCCGG - Exonic
954701957 3:52455312-52455334 CCTCGGGAAGAGGGGACAGAAGG - Intronic
960914036 3:122679572-122679594 CCTGGTGAGGAGGGAGGAGAGGG - Intergenic
961200814 3:125043853-125043875 CCTGGTTCCGAGGAGGAAGAGGG + Intronic
961451894 3:127005920-127005942 CCTGGTCACCTGGGGGCTGAGGG + Intronic
961635578 3:128330703-128330725 CCTGGGCACAAGGGGGCAGGGGG + Intronic
962954344 3:140250355-140250377 CATGGTGAAATGGGGGCAGATGG + Intronic
966427742 3:179798434-179798456 CCTGGTGAGGAGGAGACAGAGGG - Exonic
966875222 3:184317695-184317717 CCTGGTGGGGAAGGGGGAGAGGG - Exonic
968234765 3:197024965-197024987 CCTGGTGCTGAGGGGGTTGAAGG + Intronic
968647875 4:1749168-1749190 CGTGGTGGGGAGGGGGCAGGGGG - Intergenic
968647972 4:1749372-1749394 GCAGGTGAGGAGGGGGCAGATGG - Intergenic
968755554 4:2414066-2414088 CCTGGAAACGAAGTGGCAGATGG - Intronic
968951884 4:3699716-3699738 CCTGGAGGGGCGGGGGCAGAAGG + Intergenic
969260603 4:6030921-6030943 CCAGGTGATGAGGACGCAGACGG + Intronic
970215332 4:13752867-13752889 CCTGGTGATGAAGAGACAGAAGG + Intergenic
971420734 4:26471920-26471942 CCTGGTCACCCTGGGGCAGAAGG - Intergenic
973584068 4:52373716-52373738 ACTGATCAAGAGGGGGCAGAAGG + Intergenic
974279839 4:59779069-59779091 CATGGTAACAAGGGGGAAGAGGG + Intergenic
976099988 4:81551090-81551112 GCTGGTGAGGAAGGAGCAGAGGG + Intronic
979831743 4:125314233-125314255 CCAGGTGACTAGGGGGCAGGAGG - Intergenic
980277800 4:130677809-130677831 CCTGGTGAAGAGGAGGTAAAAGG - Intergenic
985558270 5:568723-568745 CACGGTGCTGAGGGGGCAGAAGG - Intergenic
986298280 5:6457236-6457258 CCTGGTGAAGATGGGCAAGAGGG - Intronic
988832251 5:34999242-34999264 CCTGGTGAAGAGGAGGCTCATGG - Intronic
991944533 5:71887083-71887105 CCTGGTGATACTGGGGCAGAAGG + Intergenic
993225563 5:85164835-85164857 CCTGGTGAAGAGTGGGCAGTTGG + Intergenic
993886489 5:93421487-93421509 GCTAGTGAAGAGGGGGCAGCTGG - Intergenic
995478985 5:112576602-112576624 CCTGGTGAAGCAGGGGGAGAAGG - Intergenic
998136466 5:139676842-139676864 GCTGGAGAGGAAGGGGCAGAGGG - Intronic
998296712 5:140977316-140977338 CCTGATGGCGAGGGGAGAGACGG + Intronic
999321310 5:150616824-150616846 GGTGGTGAGGAGGGGGTAGATGG - Intronic
1000096596 5:157976612-157976634 CCTGGTGAGTAATGGGCAGAAGG + Intergenic
1001752381 5:174141559-174141581 CCTGGTGAGTAGGTGCCAGAGGG + Intronic
1002081874 5:176742212-176742234 CCTGCTTCCAAGGGGGCAGAAGG + Intergenic
1002103929 5:176870592-176870614 CCTGGGGAGGTGGGGGCTGAGGG + Intronic
1002288054 5:178178469-178178491 TCTGGTGACGGGGAGGTAGAAGG + Intergenic
1002458809 5:179362224-179362246 CCTTATGAGGAGGAGGCAGAGGG - Intergenic
1002636216 5:180610095-180610117 CCAGGAGAAGAGGGGGCACAGGG - Intronic
1004406636 6:15339108-15339130 CCCAGTGACGAGGTGGAAGACGG + Intronic
1004409434 6:15366799-15366821 CCTGGTGATAAAGAGGCAGAAGG - Intronic
1004562204 6:16761325-16761347 CGTGGGGAAGGGGGGGCAGAGGG + Exonic
1006897154 6:37478556-37478578 CCTGGCGAGGAGAGGGGAGAGGG - Intronic
1007766190 6:44161657-44161679 GATGGTGACTAGGGGACAGAGGG + Intronic
1009946473 6:70347156-70347178 CTTGGTGAAGAGGGGGTGGAAGG + Intergenic
1012062832 6:94510940-94510962 CCTGGTGGAGACGGGGCAGGCGG - Intergenic
1012446586 6:99313182-99313204 CCTCGGGACGATGAGGCAGAAGG + Intronic
1014334317 6:120113423-120113445 CCTGGTTACGAAGGGCCAGGGGG + Intergenic
1015671330 6:135693257-135693279 CCTGGAGAAGAGAAGGCAGAAGG + Intergenic
1018861955 6:167717515-167717537 CCAGGTGAGGTGGAGGCAGAAGG - Intergenic
1020179205 7:5908219-5908241 ACTGGGGAGGAGGAGGCAGAAGG + Intronic
1020303728 7:6816637-6816659 ACTGGGGAGGAGGAGGCAGAAGG - Intronic
1023960459 7:44922067-44922089 CCTGGTGAGGAAGGGGAGGAGGG - Intergenic
1023965315 7:44960971-44960993 GCTGGGGCTGAGGGGGCAGAGGG + Intergenic
1024083637 7:45876105-45876127 CCTGGTTAGAAGGGGTCAGAGGG + Intergenic
1024214768 7:47239218-47239240 CCTGGTGACGTGGGGAAAGGGGG - Intergenic
1024676028 7:51638568-51638590 CCTGCTGAGGATGGGGCAGCTGG - Intergenic
1026915127 7:74115541-74115563 GCAGGTGGGGAGGGGGCAGAGGG + Intronic
1029364995 7:100111051-100111073 ACTGGAAACAAGGGGGCAGAGGG - Intronic
1029485425 7:100836943-100836965 CCTTGTCCCGAAGGGGCAGACGG + Intronic
1029922764 7:104283255-104283277 CCTGGTGGTAAGTGGGCAGAAGG - Intergenic
1030254620 7:107494912-107494934 GCTGGGGACGAGGGGTCAGTGGG + Intronic
1030413715 7:109213595-109213617 CCTGGTGACGTGGGCTCACAAGG + Intergenic
1032425069 7:131815969-131815991 CCTGGGGAATAGAGGGCAGAGGG - Intergenic
1034163088 7:149006633-149006655 GCTGGTGAGAAGGGAGCAGAAGG + Intronic
1034553996 7:151838344-151838366 GCTGGAGACGAGGGTGCTGAGGG - Intronic
1035374103 7:158395939-158395961 CTCTGTGACCAGGGGGCAGAGGG - Intronic
1035582007 8:746388-746410 ACTGGGGAAGAGGGGTCAGATGG + Intergenic
1035651480 8:1269138-1269160 CCCGGAGAAGAGGTGGCAGACGG - Intergenic
1036197522 8:6733347-6733369 CCTGGTGAGGGGAGGGCAGGAGG - Intronic
1044537646 8:93375612-93375634 CCTGGTGAGGAGATGGGAGAAGG - Intergenic
1047722340 8:127652865-127652887 GATGGTGACGAGGCGGCTGAAGG - Intergenic
1048440407 8:134455423-134455445 TCTGGAGAGGAGGAGGCAGAGGG + Intergenic
1049680776 8:143917029-143917051 CCTGGAGACGGCGGGGCTGATGG + Exonic
1052149318 9:25094023-25094045 TTTGGTGAGGAGGGGGCAGGGGG + Intergenic
1056363604 9:85882308-85882330 CCTGGGGAGGAGAGGTCAGATGG - Intergenic
1056618274 9:88187451-88187473 CCTGGTATCCAGGTGGCAGAGGG - Intergenic
1057359435 9:94359824-94359846 CCTGGAGAAGAGGTGGCAGGAGG + Intergenic
1057474399 9:95386294-95386316 CCTGCTGATGAGGAGGCAGCAGG - Intergenic
1057648330 9:96897768-96897790 CCTGGAGAAGAGGTGGCAGGAGG - Intergenic
1058959339 9:109978151-109978173 CCAGGTGCTGAGGTGGCAGAGGG + Intronic
1060731089 9:126037451-126037473 CCTGGTGCCGAGAGGCCAGCTGG + Intergenic
1061858273 9:133454965-133454987 CATGGTGTGGAGGGGGCATAGGG + Intronic
1062192825 9:135256486-135256508 CCAGGTGGAGAGGAGGCAGAGGG - Intergenic
1062255593 9:135619267-135619289 GGTGGTGAGGAGGGGGCACATGG + Intergenic
1186427796 X:9477983-9478005 CCTGGGGATGAAGGGGCGGAAGG - Intronic
1186920477 X:14273803-14273825 CCTAGTTACGAGGGGGACGATGG - Intergenic
1193317108 X:80077119-80077141 CCTGGTGAAGAGTGGGGAGTGGG + Intergenic
1194201570 X:90958485-90958507 CCTGGTGAAGAGGGGGCATGGGG - Intergenic
1196870636 X:120110038-120110060 CCTAGTGAGGAGGGAGCAGGAGG - Intronic
1200215157 X:154365045-154365067 CCTGATGATGAGGGGCCACATGG - Intronic
1200547410 Y:4533940-4533962 CCTGGTGAAGAGGGGGCATGGGG - Intergenic