ID: 1174340490

View in Genome Browser
Species Human (GRCh38)
Location 20:49892144-49892166
Sequence TCATCTCGTTGGACTCTTTA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174340484_1174340490 6 Left 1174340484 20:49892115-49892137 CCTGTGGCTGCCATGCAGGAGCC 0: 1
1: 0
2: 0
3: 26
4: 303
Right 1174340490 20:49892144-49892166 TCATCTCGTTGGACTCTTTAAGG 0: 1
1: 0
2: 0
3: 5
4: 64
1174340485_1174340490 -4 Left 1174340485 20:49892125-49892147 CCATGCAGGAGCCCCTGCGTCAT 0: 1
1: 0
2: 0
3: 15
4: 156
Right 1174340490 20:49892144-49892166 TCATCTCGTTGGACTCTTTAAGG 0: 1
1: 0
2: 0
3: 5
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174340490 Original CRISPR TCATCTCGTTGGACTCTTTA AGG Exonic