ID: 1174341305

View in Genome Browser
Species Human (GRCh38)
Location 20:49897984-49898006
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174341301_1174341305 5 Left 1174341301 20:49897956-49897978 CCAAAACCACTCAATGGGGAAAG No data
Right 1174341305 20:49897984-49898006 TCTCTTCACCAGATAGTGTTGGG No data
1174341303_1174341305 -1 Left 1174341303 20:49897962-49897984 CCACTCAATGGGGAAAGGACTGT No data
Right 1174341305 20:49897984-49898006 TCTCTTCACCAGATAGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174341305 Original CRISPR TCTCTTCACCAGATAGTGTT GGG Intergenic
No off target data available for this crispr