ID: 1174345812

View in Genome Browser
Species Human (GRCh38)
Location 20:49929038-49929060
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174345808_1174345812 2 Left 1174345808 20:49929013-49929035 CCTGAGGCTGATAGAACTGTGAC No data
Right 1174345812 20:49929038-49929060 CTGAGAGTTACAGGATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174345812 Original CRISPR CTGAGAGTTACAGGATTTGA GGG Intergenic