ID: 1174346772

View in Genome Browser
Species Human (GRCh38)
Location 20:49936274-49936296
Sequence CTAGCTCGCTTGCGTCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 28}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174346764_1174346772 4 Left 1174346764 20:49936247-49936269 CCACGTTTTCCAGATTTCCCTCG 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1174346772 20:49936274-49936296 CTAGCTCGCTTGCGTCAGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1174346763_1174346772 20 Left 1174346763 20:49936231-49936253 CCTTTGGATTTGGCTTCCACGTT 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1174346772 20:49936274-49936296 CTAGCTCGCTTGCGTCAGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1174346766_1174346772 -5 Left 1174346766 20:49936256-49936278 CCAGATTTCCCTCGGCCTCTAGC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1174346772 20:49936274-49936296 CTAGCTCGCTTGCGTCAGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174346772 Original CRISPR CTAGCTCGCTTGCGTCAGAG GGG Intergenic
900396870 1:2456702-2456724 CCAGCTCCCTGGCTTCAGAGGGG - Intronic
911330266 1:96518739-96518761 CTCTCTCTCTTGCGACAGAGAGG + Intergenic
916847905 1:168671986-168672008 GTAGCTGGCTTCCCTCAGAGAGG + Intergenic
1083992865 11:66257712-66257734 CTACCTCGGTGGCGTCGGAGGGG - Intronic
1090930383 11:131292698-131292720 CTAGCACCCTCGCCTCAGAGAGG + Intergenic
1094138576 12:27155857-27155879 CTAGCTCTCTTGCTTCTAAGAGG - Intergenic
1114350354 14:21843754-21843776 CTGGCTCCCTTGCCTCAGCGTGG - Intergenic
1130287613 15:82569079-82569101 CTAGCTCAGTTGCTTCAGTGAGG - Intronic
1133683288 16:8141399-8141421 CAAGCTCGCTTGAGTCTGGGAGG + Intergenic
1138902099 16:61285333-61285355 CTAGCTTTCTTGAGTCAGAATGG + Intergenic
1139677840 16:68537450-68537472 CTAAGTCACTTGCCTCAGAGAGG + Intronic
1146001320 17:29132184-29132206 CTGGCTGGCCTGAGTCAGAGGGG + Intronic
935854332 2:107258323-107258345 CTAGTTAGCTTGGGTCAGTGAGG + Intergenic
1174346772 20:49936274-49936296 CTAGCTCGCTTGCGTCAGAGGGG + Intergenic
1177693989 21:24548412-24548434 CGAGCTTGCTTTGGTCAGAGAGG - Intergenic
953536217 3:43778802-43778824 CTAGCTGGGTTGCTTTAGAGAGG + Intergenic
955078695 3:55637879-55637901 GTAGCTAACTTGAGTCAGAGGGG - Intronic
955858526 3:63300688-63300710 CTAGCTTCCTTGCCTCAGGGTGG + Intronic
959027480 3:101257169-101257191 CTAGCTGACTTACCTCAGAGAGG + Intronic
966831764 3:184016504-184016526 CTTGCTTGCTTGCTTCAGACTGG - Intronic
967745631 3:193051883-193051905 CCAGCTCCCTTGCCTCAGTGGGG - Intergenic
969292342 4:6248059-6248081 CTAACTCGCTTGTGGCAGTGGGG - Intergenic
987290749 5:16505884-16505906 CTTCCTCGCCTGCTTCAGAGTGG + Intronic
989712187 5:44412533-44412555 CTAGCTGGCTTGAGTTTGAGGGG - Intergenic
1001854874 5:175002450-175002472 CAAGCTCGCTTGCGGCAGGACGG + Intergenic
1038589985 8:28828261-28828283 CTACCTTGCTTTCGTCAGAAAGG + Intronic
1039065539 8:33604419-33604441 TTAGCTCTCTGGCCTCAGAGCGG - Intergenic
1043287076 8:78546044-78546066 CTAGCTCACTAGCCACAGAGAGG + Intronic
1058801844 9:108552072-108552094 TTAGCTCGCTTGCCTCAGATAGG - Intergenic
1203770620 EBV:48242-48264 CGAGCTCGCTGGCGTGAGACTGG - Intergenic