ID: 1174346934

View in Genome Browser
Species Human (GRCh38)
Location 20:49936893-49936915
Sequence GTGGACTAGAAAGGAAACGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174346934_1174346939 22 Left 1174346934 20:49936893-49936915 CCGACGTTTCCTTTCTAGTCCAC 0: 1
1: 0
2: 0
3: 6
4: 144
Right 1174346939 20:49936938-49936960 TTTGGCGTCGTGTCTAGCTGTGG 0: 1
1: 0
2: 0
3: 4
4: 55
1174346934_1174346937 -4 Left 1174346934 20:49936893-49936915 CCGACGTTTCCTTTCTAGTCCAC 0: 1
1: 0
2: 0
3: 6
4: 144
Right 1174346937 20:49936912-49936934 CCACGTCGCTCTTAAAGCATAGG 0: 1
1: 0
2: 0
3: 1
4: 22
1174346934_1174346938 4 Left 1174346934 20:49936893-49936915 CCGACGTTTCCTTTCTAGTCCAC 0: 1
1: 0
2: 0
3: 6
4: 144
Right 1174346938 20:49936920-49936942 CTCTTAAAGCATAGGACATTTGG 0: 1
1: 0
2: 0
3: 15
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174346934 Original CRISPR GTGGACTAGAAAGGAAACGT CGG (reversed) Intronic
901394734 1:8972764-8972786 GTGAACCAGGAAGGAAAGGTGGG - Intronic
902731828 1:18374790-18374812 GGGGACCAGCAAGGAAAGGTGGG + Intronic
903607464 1:24585308-24585330 GTGCACAAGAAAGGAAACCCGGG - Intronic
904169636 1:28582399-28582421 GTGGACAAATAAGGAAACTTAGG + Intergenic
905629400 1:39510471-39510493 TTGTTCCAGAAAGGAAACGTGGG + Intronic
905668358 1:39775722-39775744 TTGTTCCAGAAAGGAAACGTGGG - Intronic
907643523 1:56216929-56216951 TTGTACTAGGAAGGGAACGTGGG - Intergenic
908432736 1:64074556-64074578 GTGGACAAGAAATGAAAAGTGGG + Intronic
910431522 1:87164223-87164245 GTGGACTAGATGGGAAATGAGGG - Intronic
913045333 1:115069138-115069160 GTGGACGAGGAACGAAAGGTGGG + Intronic
913062862 1:115223871-115223893 GTGAAATAGAGAAGAAACGTGGG - Intergenic
919002409 1:191849534-191849556 GGGGACTAGGAGGGAAGCGTAGG + Intergenic
920058631 1:203212349-203212371 GTGTTCTAGAAAGCAAACCTGGG + Intergenic
920831075 1:209466289-209466311 GTGGATTAGAAAGAAACAGTGGG + Intergenic
922858434 1:228795095-228795117 CAGGACCAGAAAGGAAACGGAGG + Intergenic
1065466854 10:26033462-26033484 TTGGACTAAAAATGAAAAGTAGG - Intronic
1066230283 10:33425401-33425423 GTGGGGTAGAAAGGAAATGAGGG - Intergenic
1072594336 10:96856924-96856946 CTGTACTAGAAAGGAATAGTAGG + Intronic
1073673360 10:105617254-105617276 GTGGACAAGAAAGGCAGCATAGG + Intergenic
1073739042 10:106384994-106385016 CTGGACTTTAAAGGAAATGTAGG - Intergenic
1081246646 11:40775108-40775130 GTGGACAAGAAAGTAAATATTGG + Intronic
1085440895 11:76561493-76561515 ATGGAGCAGAGAGGAAACGTTGG - Intergenic
1087892777 11:103553782-103553804 GAGGATTAGAAAGGAAAACTTGG + Intergenic
1089579260 11:119471238-119471260 GCAGACTAGAAAGCAAAGGTGGG - Intergenic
1095579545 12:43781076-43781098 CTGGATCAGAAAGGAAATGTGGG - Intronic
1098511805 12:71324104-71324126 GTAGACTAGAAAAGAAAATTAGG + Intronic
1100481549 12:94984219-94984241 GTGGACAAGCTAGGAAACATGGG - Intronic
1101970884 12:109311045-109311067 TTGGAGTTGTAAGGAAACGTGGG + Intergenic
1103026456 12:117578058-117578080 GTGGAAGAGAAAGGAAGCTTGGG + Intronic
1103849679 12:123924438-123924460 GAGGAGGAGAAAGGGAACGTGGG - Intronic
1104448616 12:128852768-128852790 TGGGACTAGAAAGGAATCCTGGG + Intergenic
1104838937 12:131811225-131811247 CTGTACTAGAAAAGAAACCTGGG - Intergenic
1109268951 13:60232904-60232926 CTGGACTAAAAAGGAACTGTAGG + Intergenic
1110235095 13:73209516-73209538 GTGCACTAAAAAGGAAACACAGG - Intergenic
1113087538 13:106583621-106583643 GAGGACAATAAAGGAAACTTGGG + Intergenic
1115046914 14:29005828-29005850 GTGGAAAAGAAAGGAAGGGTAGG - Intergenic
1117246753 14:53894145-53894167 GTGGAGTAGAAAGCAATTGTTGG + Intergenic
1118032981 14:61836546-61836568 GTGGAGTAGAAAGGAAAATGAGG - Intergenic
1119193534 14:72700975-72700997 GTGGAATAGCAAGGAAAAGAGGG + Intronic
1124999703 15:34756552-34756574 GGGGAGTAGAAGGGAAACCTGGG - Intergenic
1126354580 15:47781801-47781823 GTTGAATAGGAAGGAAAAGTGGG + Intergenic
1126952914 15:53902186-53902208 TTGGACTAGAAGGGAAAACTAGG - Intergenic
1127281781 15:57499127-57499149 GTTGCCCAGGAAGGAAACGTTGG + Intronic
1127359663 15:58234098-58234120 GTGAACTACAAGGGAAACTTAGG - Intronic
1129594863 15:76954701-76954723 GTGGAACAGAAAGCAAAAGTAGG - Intergenic
1131268414 15:90932361-90932383 GGGGACTGGGAAGGAAACGTGGG - Intronic
1131538683 15:93258210-93258232 GTTTTCTAGAAAGGAAAAGTGGG - Intergenic
1131621056 15:94068526-94068548 GTGGACCAGAGTGGAAACCTGGG + Intergenic
1132297644 15:100753200-100753222 GGGGACTAGAAGGGAAAGGGTGG + Intergenic
1135476259 16:22778341-22778363 GTGGACTAGAGGGGAAGGGTGGG - Intergenic
1136951723 16:34728098-34728120 ATGGACTAGAATGGAATCATCGG - Intergenic
1136954391 16:34763744-34763766 ACGGACTCGAAAGGAAACATTGG - Intergenic
1136966655 16:34919454-34919476 ATGGACTCGAAAGGAATCATTGG - Intergenic
1137090718 16:36187046-36187068 ATGGACTTGAAAGGAATCTTTGG - Intergenic
1139216752 16:65133110-65133132 TAGGACCAGAAAGGAAAAGTTGG - Intergenic
1144005951 17:11099407-11099429 GTGGACTGGAAAGGGATCCTAGG + Intergenic
1151617375 17:75222438-75222460 TTGGGCTAGAGAGGAAAAGTTGG + Intronic
1153001400 18:458774-458796 GTGGACCAGAAATGAAACTGGGG - Intronic
1156182968 18:34627425-34627447 GTGGACTGGGAAGGAACCATGGG - Intronic
1158663710 18:59413268-59413290 GTGGACTGGAAAGAAAGCTTGGG - Intergenic
1163239480 19:16051441-16051463 GTCAACTAGAAAGGAAACGGAGG - Intergenic
1164003470 19:21128384-21128406 GTGAATTAGGAAGGAAAAGTTGG + Intergenic
1166416305 19:42596669-42596691 GTGGACTGGAAGGGAAGTGTGGG + Intronic
1168140719 19:54384999-54385021 GTGGACGGGGAAGAAAACGTGGG - Intergenic
1168157682 19:54485389-54485411 GTGGACGGGGAAGAAAACGTGGG + Intergenic
928615335 2:33032541-33032563 GTGAACTGGAAAGGAACCTTGGG + Intronic
931214606 2:60229183-60229205 TTGGCCTAGCAAGGAAACCTAGG - Intergenic
934075403 2:88424159-88424181 CTAGACCAGAAAGAAAACGTTGG + Intergenic
934702003 2:96449920-96449942 GTGGACTACAGAGGACAGGTTGG - Intergenic
935505644 2:103898898-103898920 TTGGAATAAAAAGGAAACATAGG + Intergenic
935957478 2:108391978-108392000 ATGGGCTAGAAAGGAAAGTTAGG - Intergenic
936047770 2:109200461-109200483 GGGGACTACAAAGGAAATGAAGG - Intronic
944954419 2:204791424-204791446 GTGCAGTAGTAAGGAAACATTGG + Intronic
947581181 2:231319662-231319684 GTGGAGCAGAAAGGAAATGAAGG - Intronic
948285006 2:236777369-236777391 GAGGAGAAGAAAGGAAAGGTGGG - Intergenic
1172421120 20:34818839-34818861 TTGGACGAGAAAGGAAATATAGG - Intronic
1172814476 20:37675389-37675411 ATGGAATAGAAAGAAAACATAGG + Intergenic
1173849546 20:46209358-46209380 GTGGACTGGAAAGGAGAGGGAGG + Intronic
1174346934 20:49936893-49936915 GTGGACTAGAAAGGAAACGTCGG - Intronic
1178970714 21:37174578-37174600 CTGGAGTATAAAGGAAAAGTTGG - Intronic
1179162936 21:38912826-38912848 GTGGAGAAGAAAGGAAAGGAAGG + Intergenic
1179510505 21:41869931-41869953 GTGGACTAGAAGGGAGACCCAGG - Intronic
1181325825 22:22045192-22045214 GTGCAATATAAAGGAAATGTGGG + Intergenic
953370409 3:42383017-42383039 GTGGAGTGGAAAGGAAAGCTGGG - Intergenic
956479390 3:69658873-69658895 CTGGACAAGAAAGGAAAAGCTGG + Intergenic
956725933 3:72156504-72156526 GGGGAGTAGAAAGGAAACTGGGG + Intergenic
958080212 3:88737475-88737497 CTGGGCTAGAGAGGAAACCTGGG + Intergenic
960294359 3:115925073-115925095 GTGGACTTGGAAGGAAACCCAGG - Intronic
962060676 3:131923858-131923880 GAGGATTAGAAAGAAAACCTTGG - Intronic
963344581 3:144079310-144079332 TTGGACTTGAAGTGAAACGTGGG + Intergenic
964069584 3:152615504-152615526 GTGGACCAGAATGGAAACCTGGG + Intergenic
966827082 3:183973952-183973974 GGGGAGTAGGAAGGAAACATGGG - Intronic
967953287 3:194857310-194857332 GAGGACTGGGAAGGAAAGGTAGG + Intergenic
977417262 4:96749238-96749260 GTGGTGAAGAAAGGAAAAGTTGG - Intergenic
981015627 4:139971091-139971113 GAGAACTAGAAAGGAAAACTGGG - Intronic
982597396 4:157403975-157403997 GTAGTGTGGAAAGGAAACGTGGG - Intergenic
985708961 5:1417560-1417582 CTGGACGTGAAAGGAAAGGTGGG + Intronic
988258393 5:28850278-28850300 CTGGACTACAAAGGAAATATTGG + Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
993733873 5:91452652-91452674 GTGGTCTACAAATGAAACGTAGG - Intergenic
993878564 5:93337618-93337640 GTTGACTACCAAGGACACGTAGG + Intergenic
996858291 5:128035033-128035055 GTAGACAAGAAAGGAAAGTTAGG - Intergenic
998054469 5:139062580-139062602 GAGGACTGGAAAGGAGACATGGG - Intronic
998300141 5:141010181-141010203 GCGGAGGAGAAAGGAAACTTGGG - Exonic
999141104 5:149362717-149362739 GTGTACGAGAAGGGAACCGTGGG + Exonic
1002550241 5:179983578-179983600 TTAGAATAGAAAGGAAATGTGGG - Intronic
1002592672 5:180301960-180301982 GTGGAGTGGGAAGGAAAGGTAGG + Intronic
1004342496 6:14819658-14819680 CTGGAGTAGAAGGGAAAAGTGGG - Intergenic
1005059165 6:21760304-21760326 GTGGACTAGATAGGAAACTGTGG + Intergenic
1006323499 6:33335378-33335400 CTGGACTAGAAAGGACAGATAGG - Intergenic
1008046912 6:46860367-46860389 GTGAACTTTAAAGGAATCGTGGG - Intronic
1012636607 6:101550689-101550711 GTTGACTAGAAAGGTAAAATTGG - Intronic
1017110168 6:150924877-150924899 GGAGGCTAGAAAGGAAAGGTCGG + Intronic
1020774597 7:12437041-12437063 GTGGATTAGACAGGAAAAGGGGG - Intergenic
1021240317 7:18192492-18192514 GTGGAGTGGAAAGGAATCATGGG + Intronic
1023328188 7:39083405-39083427 GTGGACTAGAATGTAAGCCTGGG + Intronic
1023678502 7:42656705-42656727 GTGGAAGAAAAAGGAAATGTGGG + Intergenic
1024419702 7:49149767-49149789 GGGGACTAAAAGGGAAAGGTTGG + Intergenic
1025566737 7:62444549-62444571 ATGGACTAGAAAGTAATCATTGG - Intergenic
1028221474 7:88202117-88202139 CTGGATTAGAAAAGAAAAGTGGG - Intronic
1031185400 7:118473438-118473460 GTGGATTGGACAGAAAACGTGGG + Intergenic
1031360913 7:120847409-120847431 ATGGACAAGAAAGGAAACTCTGG + Intronic
1031725599 7:125234174-125234196 GTTCACTAGAGAGGAAACGGAGG + Intergenic
1032352114 7:131174307-131174329 GTGGAATGAAAAGGAAACGGTGG - Intronic
1033384731 7:140861840-140861862 TTGAAGTAGAAAGGAAAAGTGGG + Intronic
1034295872 7:149972046-149972068 CTGGACTAGAAATAAAATGTGGG - Intergenic
1034587424 7:152107392-152107414 GGGCAGTAGAAAGGAAAGGTGGG + Intronic
1036190203 8:6663144-6663166 GTGGATTAGAAATGAAATTTTGG + Intergenic
1037359896 8:18062094-18062116 GAAGAGTAGAAAGGAAACGGAGG - Intronic
1038693657 8:29785592-29785614 GAGGACTAGAAAAGATACATTGG - Intergenic
1040649973 8:49436470-49436492 GTGGACTAGTAAGTAGACATTGG + Intergenic
1041456981 8:58071621-58071643 ATGGACCTGAAAGGAAATGTGGG - Intronic
1042507903 8:69580551-69580573 TTGGACAAGAAAGAAAACTTAGG - Intronic
1042953797 8:74227046-74227068 GTGGAGGATAAAGGAAAAGTTGG - Intergenic
1046480132 8:114805996-114806018 GAGAACTAAAAAGGAAACATGGG + Intergenic
1047769552 8:128019845-128019867 GTGGACAAAAAAGTAAACTTTGG + Intergenic
1049982799 9:920310-920332 GAGGACTAGCAAGGAAAAGAGGG + Intronic
1051086808 9:13359491-13359513 GAGAACTGGAAAGGAAACATTGG - Intergenic
1051792477 9:20822419-20822441 GTGGATTAGAAAGGAGAGGAAGG + Intronic
1053152282 9:35750668-35750690 GTGGAGTAGAAAGGATACACTGG - Exonic
1055024852 9:71708751-71708773 GTGGACAAGAAAGGAATCCAAGG - Intronic
1055176197 9:73320512-73320534 GAGGACTATGAAGTAAACGTTGG + Intergenic
1059099498 9:111456005-111456027 GTGTACTTGAAAGAAAACATAGG - Intronic
1060360226 9:122949072-122949094 GCGGAGTAGAAAAGAAGCGTTGG + Intronic
1203719114 Un_GL000216v2:282-304 ATGGAATGGAAAGGAAAAGTAGG - Intergenic
1203721948 Un_GL000216v2:19814-19836 ATGGAATAGAAGGGAAAGGTAGG - Intergenic
1190719443 X:53135310-53135332 TTAGACTAGAAAAGAATCGTGGG + Intergenic
1195701676 X:107710331-107710353 GTAGACTAGAACAGAAATGTGGG - Intergenic
1196634963 X:117991769-117991791 GTGGAGAAGAAAGGAAAATTAGG + Intronic
1198947600 X:142031677-142031699 CTGGGCCAGAAAGGAAACTTTGG - Intergenic
1201109070 Y:10785661-10785683 GTGGAGTGGAAAGGAATCGAGGG - Intergenic