ID: 1174352631

View in Genome Browser
Species Human (GRCh38)
Location 20:49979416-49979438
Sequence GAGCGAGGGCGGGCCTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174352620_1174352631 -1 Left 1174352620 20:49979394-49979416 CCGCCGCCTGCAGGAGGGAGTGG No data
Right 1174352631 20:49979416-49979438 GAGCGAGGGCGGGCCTGGAGGGG No data
1174352615_1174352631 17 Left 1174352615 20:49979376-49979398 CCTCTCACCTCGTGGTCTCCGCC No data
Right 1174352631 20:49979416-49979438 GAGCGAGGGCGGGCCTGGAGGGG No data
1174352623_1174352631 -7 Left 1174352623 20:49979400-49979422 CCTGCAGGAGGGAGTGGAGCGAG No data
Right 1174352631 20:49979416-49979438 GAGCGAGGGCGGGCCTGGAGGGG No data
1174352612_1174352631 26 Left 1174352612 20:49979367-49979389 CCGAAGCCTCCTCTCACCTCGTG No data
Right 1174352631 20:49979416-49979438 GAGCGAGGGCGGGCCTGGAGGGG No data
1174352622_1174352631 -4 Left 1174352622 20:49979397-49979419 CCGCCTGCAGGAGGGAGTGGAGC No data
Right 1174352631 20:49979416-49979438 GAGCGAGGGCGGGCCTGGAGGGG No data
1174352614_1174352631 20 Left 1174352614 20:49979373-49979395 CCTCCTCTCACCTCGTGGTCTCC No data
Right 1174352631 20:49979416-49979438 GAGCGAGGGCGGGCCTGGAGGGG No data
1174352611_1174352631 27 Left 1174352611 20:49979366-49979388 CCCGAAGCCTCCTCTCACCTCGT No data
Right 1174352631 20:49979416-49979438 GAGCGAGGGCGGGCCTGGAGGGG No data
1174352616_1174352631 10 Left 1174352616 20:49979383-49979405 CCTCGTGGTCTCCGCCGCCTGCA No data
Right 1174352631 20:49979416-49979438 GAGCGAGGGCGGGCCTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174352631 Original CRISPR GAGCGAGGGCGGGCCTGGAG GGG Intergenic
No off target data available for this crispr