ID: 1174353841

View in Genome Browser
Species Human (GRCh38)
Location 20:49985672-49985694
Sequence AATGGTGGGCCCAGTGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 276}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174353828_1174353841 26 Left 1174353828 20:49985623-49985645 CCCTTGAAATGTATCATTGCGGT 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1174353841 20:49985672-49985694 AATGGTGGGCCCAGTGGGTGGGG 0: 1
1: 0
2: 4
3: 29
4: 276
1174353834_1174353841 -9 Left 1174353834 20:49985658-49985680 CCATTGTGTGCCTTAATGGTGGG 0: 1
1: 0
2: 1
3: 3
4: 105
Right 1174353841 20:49985672-49985694 AATGGTGGGCCCAGTGGGTGGGG 0: 1
1: 0
2: 4
3: 29
4: 276
1174353829_1174353841 25 Left 1174353829 20:49985624-49985646 CCTTGAAATGTATCATTGCGGTC 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1174353841 20:49985672-49985694 AATGGTGGGCCCAGTGGGTGGGG 0: 1
1: 0
2: 4
3: 29
4: 276
1174353832_1174353841 -8 Left 1174353832 20:49985657-49985679 CCCATTGTGTGCCTTAATGGTGG 0: 1
1: 0
2: 0
3: 3
4: 91
Right 1174353841 20:49985672-49985694 AATGGTGGGCCCAGTGGGTGGGG 0: 1
1: 0
2: 4
3: 29
4: 276
1174353826_1174353841 27 Left 1174353826 20:49985622-49985644 CCCCTTGAAATGTATCATTGCGG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1174353841 20:49985672-49985694 AATGGTGGGCCCAGTGGGTGGGG 0: 1
1: 0
2: 4
3: 29
4: 276
1174353830_1174353841 3 Left 1174353830 20:49985646-49985668 CCTCATTGACTCCCATTGTGTGC 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1174353841 20:49985672-49985694 AATGGTGGGCCCAGTGGGTGGGG 0: 1
1: 0
2: 4
3: 29
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174353841 Original CRISPR AATGGTGGGCCCAGTGGGTG GGG Intronic
900308149 1:2020934-2020956 AATGGTGGACACAGAGGCTGTGG - Intronic
900322764 1:2093302-2093324 AAGGCTGGGGCCAGGGGGTGAGG - Intronic
901094117 1:6664557-6664579 AATGGTGGGACCTGTGAGTTGGG - Intronic
901632924 1:10656690-10656712 ACTGGTAGGCACAGTGGATGTGG + Exonic
903035606 1:20490828-20490850 GATGGAGGGCCCAGAAGGTGGGG - Intergenic
904824407 1:33265295-33265317 AATGGGGGGCCCAGAGGTTGAGG + Intronic
905174222 1:36125883-36125905 AAGGGAGGGCCCAGTGTGAGGGG + Intergenic
905240159 1:36576169-36576191 CATGGTGGGCCTTGGGGGTGGGG + Intergenic
905813053 1:40927065-40927087 AGTGGTGGGCCAAGCTGGTGGGG - Intergenic
906707278 1:47903970-47903992 AAGGTTGTGCTCAGTGGGTGTGG - Intronic
906831531 1:49036873-49036895 CAAGGTAGGCCCAGAGGGTGGGG + Intronic
908260240 1:62334657-62334679 AATGGAAGGACCAGTGGATGGGG + Intergenic
908979980 1:69944141-69944163 AATGGTGGTTCCAGGGGCTGGGG - Intronic
909729959 1:78878144-78878166 AATGGTGAACCCAGTGGGGAGGG - Intergenic
912098887 1:106181316-106181338 ACAGGTGGGCCAAGTGGGTAGGG + Intergenic
912528366 1:110302146-110302168 AATGGGGGTCCCATAGGGTGAGG - Intergenic
912802377 1:112728285-112728307 GATGGTGGGCTCATGGGGTGGGG + Intergenic
913095288 1:115510722-115510744 AATGGTGAACCCAGTGGGGAGGG + Intergenic
915303598 1:154965542-154965564 ACTGGTGGACCCTGAGGGTGTGG - Exonic
915711360 1:157902226-157902248 ACTGCTGGGCTCCGTGGGTGTGG - Intergenic
919907040 1:202085311-202085333 AATGGTGTTCTCAGTGGGTTTGG + Intergenic
920677304 1:208047240-208047262 AAGGCTGGGCCCAGTGGCTCAGG - Intronic
922772049 1:228190803-228190825 AATGGTGGTTCCAGGGGCTGAGG - Intergenic
1062888240 10:1035861-1035883 AATGGTGGGCCAGGTGGGCCAGG - Intergenic
1065122207 10:22541250-22541272 GAAGATGGGCCCTGTGGGTGGGG - Intronic
1066615457 10:37289006-37289028 AGTGGGGGGCCAAGTGGCTGTGG - Intronic
1067078955 10:43203116-43203138 CAGGGTGGGGCCAGGGGGTGGGG - Intronic
1069513970 10:69063005-69063027 AATGGCGGACTCAGAGGGTGGGG - Intergenic
1070689866 10:78516533-78516555 AATTTTGGGTCCAGTGGGAGCGG + Intergenic
1070764973 10:79051135-79051157 CATGGTGAGCTCAGAGGGTGAGG + Intergenic
1072744729 10:97932110-97932132 GATGGGGGGCCCAGTGAGTCTGG - Intronic
1072912366 10:99514780-99514802 ATTGGTGGGCACAGCAGGTGAGG - Intergenic
1073508732 10:104027850-104027872 AATGGTTGGCGCTGTGGGTAAGG + Exonic
1074580212 10:114711876-114711898 CAAGTTGGGCCCAGTTGGTGCGG - Intergenic
1074701296 10:116095026-116095048 AATGGAGGGCCCAATGGCAGAGG - Intronic
1076401533 10:130188658-130188680 AATGGTAGGCAGAGAGGGTGAGG + Intergenic
1077283009 11:1754044-1754066 CATGGTGGGCCCGGTGGATGAGG - Exonic
1077299069 11:1838956-1838978 GCTGGTGGGCCCAGGGGGAGGGG - Intergenic
1078075908 11:8160241-8160263 AATGGGGGGAAAAGTGGGTGGGG + Intronic
1078548531 11:12264037-12264059 GATGCTGGGCATAGTGGGTGAGG + Intergenic
1081109792 11:39120994-39121016 CATGGTGGGCCAAGTAAGTGGGG - Intergenic
1081854945 11:46297097-46297119 GGTGTTGGGCCCAGTGGGAGGGG - Intronic
1082701164 11:56433070-56433092 ACAGGTGGGCCAAGTTGGTGGGG - Intergenic
1083630693 11:64093711-64093733 AGCGGGAGGCCCAGTGGGTGGGG - Intronic
1084363327 11:68683297-68683319 GATATTGAGCCCAGTGGGTGGGG + Intergenic
1084545372 11:69812665-69812687 CATGGTGTACCCAGTGTGTGGGG - Intronic
1084923868 11:72495948-72495970 AATGGTGGGGCCAGTCGTGGTGG + Intergenic
1087165459 11:94998503-94998525 AATGCCGGGCCCAGTGGGAAGGG - Exonic
1088911782 11:114197665-114197687 CATGGTGGGGGCAGGGGGTGGGG + Intronic
1089693320 11:120200010-120200032 AATGCTGGGCCCTGTGAGGGGGG - Intergenic
1090387968 11:126367419-126367441 AGTGGTGGGGGCAGTGGCTGAGG + Intronic
1090390607 11:126384865-126384887 AGTGGTGGGGGCAGTGGCTGAGG + Intronic
1090807626 11:130212226-130212248 ACTGGTGGGCCCGCTGGGTGGGG + Intergenic
1092155892 12:6281239-6281261 AATGCTGGGCGCTGTTGGTGTGG - Intergenic
1093230844 12:16540000-16540022 AATGGTGCTTCCAGTGGGTTAGG - Intronic
1094159734 12:27377891-27377913 AATGGTTGGGGCAGGGGGTGTGG + Intronic
1095984268 12:47989083-47989105 GATGGAGGGGCCAGTGGGTGGGG + Intronic
1096108577 12:49014526-49014548 AATGGTGGAACCAGTGTCTGTGG - Intronic
1097088687 12:56488246-56488268 GAATGTGGGCCCGGTGGGTGGGG + Exonic
1097599721 12:61675879-61675901 ACTGTTGGCCCCAGGGGGTGCGG + Intergenic
1102573489 12:113841761-113841783 ATAGTTGGGGCCAGTGGGTGGGG + Intronic
1102646416 12:114406698-114406720 TCTGGTGGCCCCACTGGGTGGGG - Intronic
1104190458 12:126477452-126477474 GGAGGTGGGCCTAGTGGGTGGGG - Intergenic
1105813455 13:24013337-24013359 GATCGTCAGCCCAGTGGGTGAGG - Intronic
1106168908 13:27271865-27271887 ACAGGTGGGGCCAGTGGTTGGGG + Intronic
1106346838 13:28887435-28887457 CATGCTGGGCACAGCGGGTGAGG + Intronic
1106856976 13:33864257-33864279 AGAGGTGGGCCTAGTGGGAGGGG - Intronic
1107875701 13:44789018-44789040 CATGGTGGGCTCCGTGGTTGAGG + Intergenic
1111657552 13:91173060-91173082 ATAGGTGGTCCCAGTGGGAGGGG - Intergenic
1112318316 13:98384610-98384632 TAAGGTGAGCCCAGTTGGTGGGG - Intronic
1112506505 13:99979537-99979559 AACGGAGGGCCCAGAGGCTGCGG - Intergenic
1113598068 13:111548270-111548292 AATGGGGCACGCAGTGGGTGTGG + Intergenic
1115553757 14:34527519-34527541 AAAGGTGGGGGCAGAGGGTGTGG + Intronic
1118007546 14:61577190-61577212 AATGGTGGGCATAGTGGGATAGG - Intronic
1118551790 14:66959832-66959854 AATGGTGGTCCCAGAAGGAGAGG - Intronic
1118688456 14:68314841-68314863 GATGGTGGTGGCAGTGGGTGGGG - Intronic
1121733726 14:96204071-96204093 AAGAGTGGGCCCAGTGGATCTGG - Intergenic
1126559421 15:50027025-50027047 AATGGTGGGGTGAGAGGGTGGGG - Intronic
1127987181 15:64082649-64082671 AATGGTGGGGCCAGGGGAAGAGG - Intronic
1129066400 15:72907977-72907999 AATGTTGGGACCAGTTTGTGGGG + Intergenic
1129473533 15:75768029-75768051 AATGATAGGGCCTGTGGGTGGGG + Intergenic
1129731774 15:77936429-77936451 AATGAGGGGCCCTATGGGTGGGG + Intergenic
1130673888 15:85935664-85935686 AGTGCTGGGGCCAGTGGGGGTGG - Intergenic
1131259940 15:90882973-90882995 AAAGGGGGTCCCAGTGGGAGGGG + Exonic
1131777878 15:95822242-95822264 AATGGTAGGAACAGTGGGAGTGG - Intergenic
1132243654 15:100278762-100278784 AATCCTGGGCCCACTGGGTGTGG - Intronic
1132385947 15:101399841-101399863 AGAGCTGGGCCCCGTGGGTGAGG - Intronic
1133225075 16:4337111-4337133 AACGGTGGGGGCAGTGGGGGTGG + Exonic
1134336205 16:13301998-13302020 AATGGTGGGCCCAGAGTGAGGGG + Intergenic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1135108862 16:19674725-19674747 AATGGTGGTTGCAGGGGGTGGGG - Intronic
1135590994 16:23705202-23705224 AAGGGTGTGCCCTCTGGGTGAGG + Intronic
1137323146 16:47407033-47407055 AATGGTGGGCCGAGTAAGTGTGG + Intronic
1138113204 16:54340548-54340570 AGTGGTGGCCCCCGTGTGTGGGG + Intergenic
1138130873 16:54478903-54478925 AATGGTGGTCACAGTGGTAGTGG - Intergenic
1138532067 16:57639855-57639877 GATGGTGTAGCCAGTGGGTGGGG + Intronic
1139245024 16:65433232-65433254 TATTATGGGCCCAGTGCGTGTGG - Intergenic
1139657830 16:68399625-68399647 AATGTAGGGGCAAGTGGGTGGGG + Intronic
1139682403 16:68575192-68575214 CATGGTGGGCTGAGTGGATGAGG - Intronic
1139897590 16:70299877-70299899 AATGATGGACCCAGTAGGTGTGG + Intronic
1140273518 16:73487275-73487297 AATGGTGGGCAGCTTGGGTGTGG + Intergenic
1140796147 16:78440269-78440291 TATGGTGGGTCAAGTGGATGGGG - Intronic
1142026981 16:87819672-87819694 CAAGGTGGGGCCTGTGGGTGAGG + Intergenic
1142160007 16:88552475-88552497 CCCTGTGGGCCCAGTGGGTGTGG - Intergenic
1142180824 16:88668938-88668960 TATAGTGGGGCCAGTGTGTGGGG - Intergenic
1143088670 17:4435499-4435521 AAGGGAGGGCACAGTGGGGGTGG + Intronic
1143445364 17:7006049-7006071 AATGGTGGGGCCGGGGGGGGGGG + Intronic
1143451414 17:7038898-7038920 AATGGGGTTCCCAGGGGGTGAGG + Intronic
1143775134 17:9194442-9194464 AGTGGTGGGGTCAGAGGGTGTGG + Intronic
1144020246 17:11234621-11234643 AATGGTGGGCCCAGTGTTATTGG - Intergenic
1144134670 17:12281880-12281902 AATGGTGGGCAAAGTGGTGGAGG + Intergenic
1144776995 17:17789875-17789897 AGGAGTGAGCCCAGTGGGTGGGG + Intronic
1145060148 17:19728066-19728088 AAGGCAGGGCCCAATGGGTGTGG + Intergenic
1145268114 17:21390193-21390215 AGGGGTGGGCCCTGTGGGTGAGG - Intronic
1145940669 17:28741867-28741889 AATCCAGGGCCCAGTGGGAGTGG + Intronic
1145941634 17:28745921-28745943 AGGGGTGGGCCCAGGGGGAGGGG - Intronic
1146825949 17:36023464-36023486 CTTGTTGGGCTCAGTGGGTGTGG + Intergenic
1148447212 17:47744987-47745009 CATGGTGGGCCCAGGGGCAGAGG - Exonic
1148773268 17:50079072-50079094 ACAGGTGGGCCCAATGGGGGAGG + Exonic
1148894652 17:50832812-50832834 GAAGGTGGGCCCAGCGGGAGCGG - Intergenic
1149173771 17:53844888-53844910 TTGGGTGGGCCAAGTGGGTGGGG - Intergenic
1151348072 17:73515516-73515538 ACTGGTCCGCCCAGGGGGTGAGG + Intronic
1151823889 17:76512851-76512873 AATGGTGGGGACTGTGGGAGAGG + Intergenic
1152617954 17:81346352-81346374 AATGGAAGGCCCAGGGGGCGTGG + Intergenic
1152644867 17:81464069-81464091 AACGGAGGGCGCTGTGGGTGGGG - Exonic
1152782029 17:82230937-82230959 AGAGGTGGGACCAGTGGGCGCGG - Intronic
1153821624 18:8837132-8837154 ACAGGTGGGCTTAGTGGGTGGGG - Intergenic
1154217175 18:12423694-12423716 GCTGGTGGGTGCAGTGGGTGGGG + Intronic
1155153789 18:23142060-23142082 AATGGTGGACCCAGAAGGGGTGG - Intronic
1155552102 18:26975420-26975442 AGTGGTGGGGGCAGTGGGAGGGG - Intronic
1155619248 18:27757754-27757776 AAGTGTTGGCCCAGTGGATGTGG + Intergenic
1156048171 18:32900610-32900632 AGAGGTGGGCCAAGTGGATGGGG + Intergenic
1156846091 18:41666741-41666763 AATGGTCGGCTCAGTGTGTTTGG - Intergenic
1157483216 18:48069185-48069207 AGGGGTGGGCCCAGTGACTGTGG - Intronic
1160098800 18:75901551-75901573 ATTGGTGGGGCCAGGGGGTCTGG + Intergenic
1160753804 19:747590-747612 GAAGGAGGGCCCAGTGGGGGCGG - Exonic
1161242153 19:3228513-3228535 AACGGGGGGCCCAGTGGCAGCGG - Intronic
1161361997 19:3855687-3855709 CATGGCGGGCCTGGTGGGTGAGG + Intronic
1161659234 19:5535945-5535967 AATGGGGGGCCCTGTGTCTGAGG - Intergenic
1161958526 19:7509512-7509534 AATGGTGGGGACACTGGATGTGG + Intronic
1162021818 19:7871535-7871557 GAAGGTGGGGCCTGTGGGTGGGG + Exonic
1162504954 19:11078208-11078230 GGTGGTGGGGGCAGTGGGTGGGG - Intergenic
1164705291 19:30314900-30314922 GAGAGTGGGGCCAGTGGGTGGGG - Intronic
1164812900 19:31171997-31172019 AATGGAGGGTCCCGTGGTTGGGG + Intergenic
1165130769 19:33630454-33630476 ACTGGTGGGGCCAGTGCATGGGG + Intronic
1165130786 19:33630532-33630554 ACTGGTGGGGCCAGTGCGTGGGG + Intronic
1165130801 19:33630610-33630632 ACTGGTGGGGCCAGTGCATGGGG + Intronic
1165146559 19:33734748-33734770 TATGCTGGGCCCAGTGGGAGTGG - Intronic
1165706062 19:37977125-37977147 AATGGTAGGCTAGGTGGGTGAGG - Intronic
1165746788 19:38234211-38234233 AAAGCTGGACCCAGTGGGTATGG - Intergenic
1166319215 19:42006137-42006159 GGTGGTGGGCACAGTGGCTGTGG - Intronic
1166558242 19:43715900-43715922 ACTGGAGGGCCCAGTGTGAGTGG + Intergenic
1167707343 19:51089418-51089440 AGTGGGGGGCCAAGTGGGTGAGG + Intergenic
1167726418 19:51216086-51216108 AGGGCTTGGCCCAGTGGGTGTGG - Intergenic
1168493976 19:56835158-56835180 GAGGGTGGACGCAGTGGGTGTGG - Intronic
1168686675 19:58353245-58353267 AATGGTGGGCCCAGGCCGGGGGG - Intronic
925146669 2:1587201-1587223 CAGGGAGGGCCCTGTGGGTGGGG - Intergenic
925216476 2:2100401-2100423 AAAGGAGGGCTCAGTGGGTTGGG - Intronic
926421441 2:12703747-12703769 AATAGTGGCCCCACAGGGTGGGG - Intergenic
927130448 2:20054139-20054161 AATGGATGGGCCGGTGGGTGGGG - Intergenic
929666888 2:43840232-43840254 AATGGTGGGCTCCTTGGGTCTGG - Intronic
929962085 2:46504501-46504523 AGGGGTGGGCACAGTGGGAGGGG - Intronic
931520680 2:63093612-63093634 GATACTGGGCCAAGTGGGTGAGG + Intergenic
932425304 2:71630436-71630458 CCTGGTGGGCCTAGTGGGAGAGG - Intronic
935055619 2:99563958-99563980 ATCAGTGGGCACAGTGGGTGTGG + Intronic
935277340 2:101486246-101486268 AGAGGTGAGCCCAGTGGGTATGG - Intergenic
936482201 2:112894029-112894051 ACTGGTGTGGCCAGTTGGTGGGG - Intergenic
938186197 2:129234136-129234158 AATGATGGGAGCAGTGAGTGCGG + Intergenic
938730329 2:134142206-134142228 AAAGGTGGGCCCTGTGGTTTAGG + Intronic
938761035 2:134426158-134426180 ATTGCTGGACCCTGTGGGTGAGG - Intronic
938779857 2:134575331-134575353 AATGGTGGGCACTGGGGGTGGGG - Intronic
941430503 2:165408577-165408599 AAGTATGGGCCCTGTGGGTGAGG + Intergenic
942046700 2:172103032-172103054 CATGGTGGGCGCTGTGGCTGCGG + Intergenic
942828267 2:180206977-180206999 AATGGTGGGACAAATGAGTGGGG - Intergenic
946403222 2:219479753-219479775 AATAGTGGGCCCAGAGTCTGAGG - Intronic
946555127 2:220847867-220847889 AAGGCTGGTCTCAGTGGGTGGGG + Intergenic
1169342205 20:4805087-4805109 AATGCTGGGCCATGTGAGTGTGG + Intronic
1171300461 20:24055361-24055383 TATGGTGGGGACAGTGGGAGCGG + Intergenic
1173414785 20:42845938-42845960 TATGCTGGGCCAAGTAGGTGTGG - Intronic
1174294981 20:49539539-49539561 CATGGGGGCCCCAGTGGGTGGGG - Intronic
1174353841 20:49985672-49985694 AATGGTGGGCCCAGTGGGTGGGG + Intronic
1175670954 20:60902552-60902574 AGAGGTGGGGCAAGTGGGTGAGG + Intergenic
1175892346 20:62321347-62321369 AGAGGTGGGGCCAGTGGGGGTGG + Intronic
1175998667 20:62822303-62822325 AATGGTGGGGGCAGTGGCTGTGG + Intronic
1176132802 20:63503362-63503384 AATGGGGGGTCCAGTGTCTGTGG + Intergenic
1176132811 20:63503399-63503421 AATGGGGGGTCCAGTGTCTGTGG + Intergenic
1176132820 20:63503436-63503458 AATGGGGGGTCCAGTGTCTGTGG + Intergenic
1176155909 20:63620340-63620362 AATGGTGGCCCAAGAGTGTGGGG + Intronic
1176231218 20:64034060-64034082 CATGGCTGGCCCAGAGGGTGTGG + Intronic
1178466523 21:32853499-32853521 ACTGGTGGGCCAAGTGGGCAGGG - Intergenic
1178924066 21:36760744-36760766 AATGGTGTGGCCTGGGGGTGGGG + Intronic
1180073241 21:45449182-45449204 AAGGGTGGGCCCTGGGGCTGCGG + Intronic
1180084615 21:45502199-45502221 GATGGGGGGCCCTGGGGGTGTGG + Intronic
1180785199 22:18543310-18543332 GATGGCGGGCCCAGTGTGGGAGG - Intergenic
1181089616 22:20463661-20463683 AGTTGTGCCCCCAGTGGGTGTGG - Intronic
1181242102 22:21482663-21482685 GATGGCGGGCCCAGTGTGGGAGG - Intergenic
1181469584 22:23129429-23129451 AATGGTGCGCCCAGTGTTGGTGG + Intronic
1181764603 22:25082206-25082228 GATGCTGGGCCCAGAGGGGGTGG - Intronic
1182501020 22:30747681-30747703 AGAGCTGAGCCCAGTGGGTGGGG - Intronic
1183284145 22:36952047-36952069 AGTGGTGGGCAGAGGGGGTGGGG + Intergenic
1183390147 22:37541077-37541099 AATGGTGGGTACTGTGGGAGGGG - Intergenic
950428861 3:12939411-12939433 ACTGGAGGGCACAGTGGGTCAGG + Intronic
953956293 3:47234532-47234554 AATGCTGGGCACAGTGGCTCTGG - Intronic
954412163 3:50375550-50375572 GATGGTGGTCACAGTGGGAGAGG + Intronic
955707399 3:61742658-61742680 CATGGTGGCCAAAGTGGGTGAGG - Intronic
956158323 3:66321570-66321592 AATTGTGTGTCCAGTGGGTGGGG + Intronic
959405327 3:105955460-105955482 AATGGTGGGAACAGAGGATGAGG - Intergenic
960513848 3:118581167-118581189 TAAGGAGGGCCCAGTGTGTGAGG - Intergenic
961414751 3:126749140-126749162 AAGGGTGTGAACAGTGGGTGGGG + Intronic
961782028 3:129326037-129326059 AGTGTTGGCCCCAGTGGGAGGGG - Intergenic
961824781 3:129593273-129593295 TGTGGTGGGCGCAGCGGGTGGGG - Intronic
964707375 3:159633435-159633457 GATGGTGTGCCCTGTGGGTGGGG - Intronic
964722017 3:159776921-159776943 AGCAGTGGGCCCAGTGGGAGAGG + Intronic
968404418 4:327427-327449 GATGGAGTGCCCAGGGGGTGCGG + Intergenic
968622139 4:1608556-1608578 GTGGGAGGGCCCAGTGGGTGGGG + Intergenic
971029867 4:22624266-22624288 AGTGGTGGGGGCAGTGGGAGGGG - Intergenic
974246004 4:59318678-59318700 AATGGTGGGCATAATGTGTGGGG + Intergenic
975328004 4:73081853-73081875 AAAAGTGGGGCCACTGGGTGTGG + Intronic
975453532 4:74559331-74559353 ATCTGTGGGCCCTGTGGGTGTGG - Intergenic
976282008 4:83334908-83334930 GATGGAGGGCGCAGTGGGAGGGG - Intronic
977666887 4:99653188-99653210 AGTGCCAGGCCCAGTGGGTGGGG + Exonic
980915718 4:139031488-139031510 AATGGTGGGCCAAGTCAGTTTGG + Intronic
981606812 4:146548320-146548342 AAAGGTGGGCACAGAGGCTGTGG + Intergenic
982003216 4:151040027-151040049 AATGTTTGCTCCAGTGGGTGTGG - Intergenic
984861026 4:184238636-184238658 ACTGATGGGGACAGTGGGTGGGG - Intergenic
985275133 4:188230983-188231005 AAAGGTGGGCAAAGTGGGAGAGG + Intergenic
986761083 5:10880316-10880338 AATGGTGGTTCCAGAGGTTGTGG + Intergenic
994078620 5:95681374-95681396 AAGGGTGGGATCAGTGGGTAGGG - Intronic
994995580 5:107058258-107058280 CAAGGTGGGCACAGTGGGTGTGG + Intergenic
997716823 5:136048763-136048785 AAGGGAGAGGCCAGTGGGTGAGG + Intronic
1000386631 5:160680728-160680750 CATGCTGGGCTCTGTGGGTGGGG + Intronic
1002583082 5:180222334-180222356 GATGGTAGGCCCTGTGGGAGTGG - Intergenic
1002652493 5:180710420-180710442 AATGGGAGTCCCAGGGGGTGAGG + Intergenic
1003232686 6:4269039-4269061 GAAGGTGGGCCTAGTGGGAGGGG - Intergenic
1005811339 6:29518612-29518634 AATGGGGGGCCCTGTGGGTGGGG + Intergenic
1006302100 6:33199254-33199276 AAGGGAGAGCCCAGTGGGGGTGG + Exonic
1006330398 6:33386242-33386264 AGTGCTGGGCCCAGCGGCTGGGG - Intergenic
1006793178 6:36716698-36716720 ACTGGTGGGGCAAGGGGGTGGGG + Intronic
1006799161 6:36748555-36748577 ACAGGTGGGCCCAGGGGGTAGGG - Intronic
1007268947 6:40620975-40620997 AAAGATGGCCCCAGTGGGTTTGG + Intergenic
1012475639 6:99613263-99613285 GGTGGCGGGCCCAGGGGGTGGGG - Exonic
1012530231 6:100226804-100226826 AATGGTGGTGCCAGGGGCTGGGG - Intergenic
1014928379 6:127302679-127302701 AAGGCTGGGCACAGTGGGTCAGG - Intronic
1016167335 6:140962973-140962995 AAAAGTGGGCTGAGTGGGTGTGG - Intergenic
1016702520 6:147069639-147069661 ATAGGTGGGCCAAGTGGGTGGGG + Intergenic
1017454709 6:154591069-154591091 AATGGTTGGCACAGTGAATGTGG - Intergenic
1018027131 6:159815395-159815417 AAGGGAGGGCCAAGAGGGTGGGG - Intronic
1018732979 6:166667069-166667091 AATGGTGGCACCAGAGGATGAGG + Intronic
1019579325 7:1752277-1752299 CATGGTGGCCCCTCTGGGTGGGG - Intergenic
1021115709 7:16744551-16744573 AACGGTGGGCCAAGTGGGTGGGG - Intergenic
1021318510 7:19182095-19182117 AGTGCTGGTGCCAGTGGGTGTGG - Intergenic
1022171614 7:27837329-27837351 GGTGGTGGGCTCAGTGGTTGTGG + Intronic
1024903716 7:54352219-54352241 GGTGGTGGGCACACTGGGTGGGG + Intergenic
1025855035 7:65269252-65269274 AATGCTGGGGACGGTGGGTGTGG + Intergenic
1026282572 7:68934656-68934678 AATGGTGGGGCCAGTGAGGAGGG + Intergenic
1028361365 7:89970651-89970673 AATGGTGGTGCCAGAGGATGGGG - Intergenic
1028522493 7:91747509-91747531 CATGGTGGCCCCATTGGTTGAGG - Intronic
1028887323 7:95948476-95948498 AGTAGTGGGCACAGTGGGAGTGG + Intronic
1032828578 7:135597262-135597284 ATCTGTGGGTCCAGTGGGTGAGG + Intronic
1034853110 7:154514553-154514575 AATGGTGGGTGCAGGGGCTGGGG - Intronic
1035338044 7:158142619-158142641 GTTGGTGGGCCCTGGGGGTGTGG - Intronic
1038670289 8:29577563-29577585 CAAGGTGAGCCCAGTGAGTGAGG - Intergenic
1045998427 8:108390883-108390905 AATTGTGGGGGCAGTGGGGGAGG - Intronic
1048307331 8:133293359-133293381 AAAGGTGGGCCCAGAGGGTGTGG + Intronic
1049057066 8:140245289-140245311 GGTGGTGGGCCCTGTGGGCGAGG - Intronic
1049241963 8:141542532-141542554 CATGGAAGGCCCAATGGGTGGGG + Intergenic
1052681969 9:31704820-31704842 ATTGATGGGCCCATTGGGTCAGG - Intergenic
1053287806 9:36861113-36861135 AATGCAGGGCTCAGTGGGAGGGG + Intronic
1056248661 9:84725477-84725499 AATGATGGGCCCTGGGTGTGGGG + Intronic
1057602202 9:96468236-96468258 AATGCTGGGTGTAGTGGGTGTGG - Intronic
1058484415 9:105429171-105429193 AATTGTGTGCCCTGTGGATGTGG - Intronic
1059169948 9:112115514-112115536 AATTGTGGGCCAAGTGGGTGCGG + Intronic
1060734980 9:126061186-126061208 AATTGTGGGCACACTGGCTGGGG + Intergenic
1060827447 9:126695158-126695180 GAGGCTGGGGCCAGTGGGTGAGG - Intronic
1061043830 9:128153868-128153890 CACTGTGGGCCCCGTGGGTGAGG + Intergenic
1061901742 9:133676335-133676357 AATGGAGGGCACAGGGGCTGGGG + Intronic
1062282055 9:135756604-135756626 GATGGAGGGTGCAGTGGGTGAGG - Intronic
1062286934 9:135777572-135777594 AAGGGTGGGCCCAGTTGGGGAGG - Intronic
1062696841 9:137879983-137880005 AAGTGGGGGCCCAGGGGGTGCGG + Intronic
1185469999 X:376534-376556 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470015 X:376595-376617 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470091 X:376892-376914 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470107 X:376953-376975 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470123 X:377014-377036 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470199 X:377311-377333 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470288 X:377665-377687 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185550602 X:980602-980624 CATGGCAGCCCCAGTGGGTGAGG - Intergenic
1186260988 X:7779224-7779246 AATGGTGTGCCCAGTAACTGAGG + Intergenic
1187252678 X:17613089-17613111 AAGGCTGGGCACAGTGGCTGAGG + Intronic
1191920112 X:66246581-66246603 CATGGTGGGGGCAGTGTGTGGGG + Intronic
1197269008 X:124405638-124405660 GATGGTGGGCCCAGGTGGTAAGG - Intronic
1197453160 X:126642834-126642856 ATTGGTGGGGCCAGTGACTGAGG - Intergenic
1197705615 X:129632521-129632543 GCTGGTGGGCCTGGTGGGTGTGG - Intergenic