ID: 1174354250

View in Genome Browser
Species Human (GRCh38)
Location 20:49987826-49987848
Sequence CCGAGTGAGCCGTGGGACAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174354250_1174354256 1 Left 1174354250 20:49987826-49987848 CCGTTGTCCCACGGCTCACTCGG 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1174354256 20:49987850-49987872 CTTTCTGGCGTTCTCTCCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174354250 Original CRISPR CCGAGTGAGCCGTGGGACAA CGG (reversed) Intronic
901749213 1:11395764-11395786 CCGAGAGAGCCGAGGGAGAGAGG - Intergenic
902471415 1:16649316-16649338 ACAAGTGAGCCTTGGGGCAACGG + Intergenic
902487395 1:16758129-16758151 ACAAGTGAGCCTTGGGGCAACGG - Intronic
908419200 1:63943231-63943253 CTGAGTGAGTTGTGGCACAATGG - Intronic
908476525 1:64494020-64494042 GGGAGGGAGCGGTGGGACAAGGG + Intronic
915147422 1:153803260-153803282 CCGAGTGAGCAGGTGGGCAAAGG + Intergenic
920455653 1:206099176-206099198 CCAAGTGAGGCGTGGAACCATGG + Intronic
923045329 1:230351391-230351413 CCAAGTGAGAGTTGGGACAAGGG - Intronic
924384322 1:243487976-243487998 CCGGGGGAGCCGTGGGGAAATGG + Intronic
924932710 1:248745030-248745052 CCAGGGGAGTCGTGGGACAAGGG - Intronic
1064194064 10:13231307-13231329 CCGAGTGAGAGGTGGGGCATGGG - Intronic
1067469655 10:46527375-46527397 CCCAGTGACCCCAGGGACAAAGG - Intergenic
1071975289 10:90949199-90949221 CTGAGTGAGACATGGTACAAAGG + Intergenic
1081720030 11:45281911-45281933 AGGACTGAGCCGTGGGGCAAGGG + Intronic
1084625389 11:70302310-70302332 CCCAGGGAGCAGTGGGAGAAGGG + Intronic
1096772597 12:53945503-53945525 CCGAGTGGGCCGTGCGAGGAAGG + Exonic
1100032412 12:90209289-90209311 CCTAGTGAGCTGTGGGAAGAGGG + Intergenic
1100155991 12:91801099-91801121 CAGAGTCAGCCTTGGGCCAATGG - Intergenic
1103091025 12:118098207-118098229 CAGAGAGAGCAGTGGGACAGTGG - Intronic
1103911820 12:124356160-124356182 CCGAGGGATGCGTGGGCCAAGGG - Intronic
1104729074 12:131095064-131095086 CTGAGTGAGCCCTGGGAACAGGG + Intronic
1110860200 13:80339444-80339466 CGGAGTGAGCAGTGGGACCCTGG - Exonic
1114513315 14:23280265-23280287 CCAAGTCAGCCTTGGAACAAAGG + Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1127659079 15:61083197-61083219 CCGTGTCAGCCTCGGGACAACGG - Intronic
1141116881 16:81316007-81316029 CCGTGAGAGCCTTGCGACAAAGG + Intronic
1150840347 17:68600903-68600925 CCGAGTGAGCCGAGGGAATGGGG + Exonic
1152181324 17:78823503-78823525 CCCACTGAGCCTGGGGACAAAGG + Intronic
1162352604 19:10159782-10159804 GCTGGTGAGCAGTGGGACAAGGG + Intronic
1163061390 19:14764632-14764654 CCTAGTGAGCCATGGGCCAGAGG + Intronic
1165952634 19:39482809-39482831 CCGAGGGAGGAGTGGGATAAGGG - Intronic
1202703813 1_KI270713v1_random:6111-6133 ACAAGTGAGCCTTGGGGCAACGG + Intergenic
929385356 2:41400212-41400234 CTGAGTGAGAGGTGGGACAAAGG + Intergenic
933099722 2:78238183-78238205 CTGATTGAGCCATGTGACAAGGG + Intergenic
939371463 2:141306855-141306877 CTGAGTGACCCCTGGGTCAAAGG - Intronic
945833177 2:214809882-214809904 CCGCGAGAGCCGTGGGACCGAGG + Intergenic
946338843 2:219055857-219055879 CCGAGTGCTCTGTGGGAGAAAGG + Exonic
1168840963 20:909936-909958 CCTAGGGAGCCTTGGGCCAAGGG + Intronic
1169009351 20:2237408-2237430 CCGAGTGAGCCTTGGGCCCCCGG - Intergenic
1172304679 20:33872398-33872420 CCGAGTGGGACGTGGGGCATTGG + Intergenic
1174354250 20:49987826-49987848 CCGAGTGAGCCGTGGGACAACGG - Intronic
1175227421 20:57452660-57452682 CTGAGTGAGACGGGGGACAACGG + Intergenic
1175549395 20:59807026-59807048 CCGAGTGAGCAGTGAGTGAACGG + Intronic
1175871476 20:62211385-62211407 CCGAGGGTGGCGTGGGACAGAGG + Intergenic
1184278988 22:43426548-43426570 CCGAGTGGTCCGAGGGACAGCGG - Intronic
950901993 3:16506204-16506226 CAGAGCGAGCCATGGGATAAGGG + Intronic
954298015 3:49684925-49684947 ACAAGTGAGCCTTGGGGCAATGG - Intronic
961556591 3:127700459-127700481 CCAAGTGAGGCATGGGAGAAGGG - Intronic
968655438 4:1776591-1776613 CCGAGTGGCCCCTGGGACAGGGG - Intergenic
970874658 4:20855451-20855473 CCAACTGACCCATGGGACAAGGG - Intronic
972637824 4:40899876-40899898 GCCAGTGAGCCGTGGGATACAGG + Intronic
975570127 4:75808058-75808080 CTGAGTAAGTGGTGGGACAATGG - Intronic
985934910 5:3090028-3090050 CCGAGTAAGCCATAGGACCAAGG + Intergenic
994654123 5:102568299-102568321 CCGAATGACCAGTGGGATAATGG - Intergenic
998041487 5:138953479-138953501 CAGAGTGACACGTGGTACAAAGG - Intronic
1002103640 5:176869394-176869416 CCGAGTGCCCCCTGGGAGAAGGG + Intronic
1003369123 6:5507780-5507802 CGGAGGGAGCAGAGGGACAAGGG + Intronic
1017207415 6:151818376-151818398 CCCAGAGAGCCCTGGGACAGGGG - Intronic
1024576642 7:50769853-50769875 CCGAGAGTGCCTTGGAACAAAGG - Intronic
1033037185 7:137885670-137885692 CCCAGTGAGCTCTGTGACAATGG - Intronic
1033058107 7:138078827-138078849 CTGAATGAGCCATGGGGCAAAGG + Intronic
1047324021 8:123819299-123819321 CAGGGAGAGCCGTGGGACCAGGG + Intergenic
1049584227 8:143425572-143425594 CCGCGTGAGCCCTGGGAGAGGGG - Intronic
1198177795 X:134172845-134172867 CCCACGGAGCCGTGGGACAGGGG + Intergenic