ID: 1174354335

View in Genome Browser
Species Human (GRCh38)
Location 20:49988219-49988241
Sequence CTGGTTCTGTGTCCTCTGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 2, 3: 63, 4: 482}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174354330_1174354335 6 Left 1174354330 20:49988190-49988212 CCCCACAGGACTTTGATGAAGAC 0: 1
1: 0
2: 3
3: 23
4: 228
Right 1174354335 20:49988219-49988241 CTGGTTCTGTGTCCTCTGCCTGG 0: 1
1: 0
2: 2
3: 63
4: 482
1174354326_1174354335 26 Left 1174354326 20:49988170-49988192 CCCACTTCTGGCCACATCAGCCC 0: 1
1: 0
2: 3
3: 24
4: 218
Right 1174354335 20:49988219-49988241 CTGGTTCTGTGTCCTCTGCCTGG 0: 1
1: 0
2: 2
3: 63
4: 482
1174354331_1174354335 5 Left 1174354331 20:49988191-49988213 CCCACAGGACTTTGATGAAGACC 0: 1
1: 0
2: 1
3: 13
4: 121
Right 1174354335 20:49988219-49988241 CTGGTTCTGTGTCCTCTGCCTGG 0: 1
1: 0
2: 2
3: 63
4: 482
1174354327_1174354335 25 Left 1174354327 20:49988171-49988193 CCACTTCTGGCCACATCAGCCCC 0: 1
1: 0
2: 3
3: 35
4: 328
Right 1174354335 20:49988219-49988241 CTGGTTCTGTGTCCTCTGCCTGG 0: 1
1: 0
2: 2
3: 63
4: 482
1174354329_1174354335 15 Left 1174354329 20:49988181-49988203 CCACATCAGCCCCACAGGACTTT 0: 1
1: 1
2: 2
3: 19
4: 242
Right 1174354335 20:49988219-49988241 CTGGTTCTGTGTCCTCTGCCTGG 0: 1
1: 0
2: 2
3: 63
4: 482
1174354332_1174354335 4 Left 1174354332 20:49988192-49988214 CCACAGGACTTTGATGAAGACCA 0: 1
1: 0
2: 3
3: 17
4: 168
Right 1174354335 20:49988219-49988241 CTGGTTCTGTGTCCTCTGCCTGG 0: 1
1: 0
2: 2
3: 63
4: 482
1174354325_1174354335 27 Left 1174354325 20:49988169-49988191 CCCCACTTCTGGCCACATCAGCC 0: 1
1: 0
2: 4
3: 27
4: 264
Right 1174354335 20:49988219-49988241 CTGGTTCTGTGTCCTCTGCCTGG 0: 1
1: 0
2: 2
3: 63
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174354335 Original CRISPR CTGGTTCTGTGTCCTCTGCC TGG Exonic
900179085 1:1303515-1303537 CTGGCCCTGGGTCCCCTGCCTGG - Intronic
900296140 1:1951332-1951354 CTGGCTCTGTGTCCCCACCCAGG - Intronic
900934813 1:5758594-5758616 CTGGCTCTGAGGCCTCAGCCTGG - Intergenic
901031128 1:6307612-6307634 CTGTTGCTGTTCCCTCTGCCAGG - Intronic
901031136 1:6307651-6307673 CTGTTACTGTTCCCTCTGCCTGG - Intronic
902254989 1:15182737-15182759 ATATTTCTGTGTCCTCTGTCAGG - Intronic
902695879 1:18140615-18140637 CTCCTGCTGTGCCCTCTGCCTGG + Intronic
902729022 1:18356643-18356665 CTTTTTATGTGTCCTATGCCTGG - Intronic
902792646 1:18779405-18779427 CTTCTGCTGTGTCCTCTGCCTGG - Intergenic
903573539 1:24323423-24323445 CTGCTTCCCAGTCCTCTGCCTGG - Intronic
903764789 1:25727330-25727352 CTGGTGGTATTTCCTCTGCCAGG + Intronic
904266583 1:29321847-29321869 CTGGTTCAGTGACCTCAGCCTGG + Intronic
905184487 1:36186744-36186766 CGTGTGCTGTTTCCTCTGCCTGG - Intergenic
905261068 1:36719687-36719709 CTGGCTCTTTCTCCTCTACCAGG + Intergenic
905294362 1:36944857-36944879 CTCTTCCTGTGTCCTCTGCCAGG - Intronic
905353345 1:37362855-37362877 CTGGTGCTGGTTCCCCTGCCTGG - Intergenic
905480839 1:38260927-38260949 CTGGAGCTGTGCCCTCTTCCTGG + Intergenic
905508523 1:38500044-38500066 CCCATGCTGTGTCCTCTGCCTGG + Intergenic
905787161 1:40767505-40767527 CTGTTTCTGTGCCCACTCCCCGG + Intronic
905804553 1:40866344-40866366 CTCTTGCTGTGCCCTCTGCCTGG + Intergenic
905990543 1:42334511-42334533 CTGTGTCTGTGTCCTTTGCTGGG - Intronic
906036837 1:42755798-42755820 TAATTTCTGTGTCCTCTGCCTGG + Intronic
906188283 1:43878537-43878559 CTAGAGCTGTTTCCTCTGCCTGG - Intronic
906584140 1:46961601-46961623 CTGGACCTGTGTCCTATGCCTGG + Intergenic
906931825 1:50177530-50177552 CATGTGCTGTTTCCTCTGCCTGG - Intronic
907246003 1:53109615-53109637 CTGGTTCTCAGTTCTCTTCCTGG + Intronic
907487747 1:54788939-54788961 CTGGATCTGCTTCCCCTGCCAGG - Intronic
907562285 1:55402112-55402134 CTGGTTCTGTGTCCTTTCTTTGG + Intergenic
908320364 1:62972598-62972620 GTGTTTCTGTTTTCTCTGCCTGG + Intergenic
908679841 1:66648426-66648448 ATGGTTCTGTGTCCTTAGCCTGG - Intronic
910136603 1:83979322-83979344 CTGGTCCTGTGGCCTCCACCCGG - Intronic
911784793 1:101932696-101932718 CTGGTTCTTTGTCATCTGTGTGG - Intronic
912184688 1:107261158-107261180 CAGGTCCTGGGTCCTGTGCCAGG + Intronic
912330820 1:108818641-108818663 TTGGTTCTGTGTCCTTGGGCAGG - Intronic
913516814 1:119612042-119612064 CTCGGTCTGTGCCCACTGCCTGG - Intergenic
913997798 1:143665698-143665720 CTGGTTGTGTTCCCACTGCCCGG - Intergenic
915874960 1:159602609-159602631 CTTTTTCTGTGTCCTTTGCAGGG + Intergenic
916516879 1:165526703-165526725 CTGCTTCTCTGCCCTCTGCTGGG - Intergenic
917683971 1:177397006-177397028 CTGGCTCTGCTTCCTCTACCTGG - Intergenic
917704490 1:177618298-177618320 ATCTTTCTGTTTCCTCTGCCTGG - Intergenic
917970290 1:180201758-180201780 CTGGGCCTCTGCCCTCTGCCTGG + Exonic
918351623 1:183661735-183661757 TTGGTTGTGTCTCTTCTGCCCGG - Intronic
919925120 1:202188206-202188228 CTGGCTCTGTGCCCTCTTCAGGG + Intergenic
920296140 1:204958082-204958104 CTGGTTCTGGGTACGCTGCCAGG - Intronic
920440317 1:205976243-205976265 TTGGCTCAGTTTCCTCTGCCTGG + Intergenic
921524301 1:216198340-216198362 CTGGAAGTGTGTCTTCTGCCTGG - Exonic
921606068 1:217156630-217156652 ATGTTTCTGTGTTCTCTGTCTGG + Intergenic
923045340 1:230351431-230351453 TGGGTCCTGTGTCCTCTGGCTGG + Intronic
923367243 1:233274703-233274725 CTCATGCTGTTTCCTCTGCCTGG - Intronic
923557643 1:235013298-235013320 CTGGTTCTGGGTCCTTTGGAAGG + Intergenic
923764479 1:236880322-236880344 CATATCCTGTGTCCTCTGCCTGG + Intronic
923782036 1:237033260-237033282 CTGGTTCTGTGCTCGCTTCCTGG - Intergenic
924525441 1:244843329-244843351 CTGGCCCTGTGTCTACTGCCAGG + Exonic
1062800813 10:379097-379119 CAGGTGCTGTGCCCTCTGTCAGG - Intronic
1063363979 10:5478803-5478825 GCGGTGCTGTGTCCTCTCCCAGG + Intergenic
1063980669 10:11449185-11449207 CTTTTTCTGTGTCTGCTGCCTGG - Intergenic
1064027954 10:11864018-11864040 CTGGCTCCGTGTCTTCTGTCTGG + Intronic
1064085013 10:12339037-12339059 CTGGCTCTTTGTTCTTTGCCTGG - Intergenic
1064998408 10:21316100-21316122 CTGGTTCTGTTCCGGCTGCCTGG - Intergenic
1066399386 10:35060327-35060349 CTGGTGCTGTTCCATCTGCCTGG - Intronic
1067187462 10:44043088-44043110 CTGATTCTGTCTCCTGTGCCTGG + Intergenic
1067287327 10:44916071-44916093 CTGGCCATGTGACCTCTGCCAGG - Intronic
1067777662 10:49175110-49175132 CTTGTACCTTGTCCTCTGCCTGG - Intronic
1068681720 10:59827137-59827159 ATGGATCTGTTTCCTCTGCCTGG - Intronic
1069108490 10:64413321-64413343 TGTTTTCTGTGTCCTCTGCCAGG - Intergenic
1070809869 10:79292313-79292335 CTTGTTCTGTGTCTCCTGCAGGG - Exonic
1070914635 10:80144952-80144974 CTGGTTCTGTGGGCGCTGCCTGG - Exonic
1071230300 10:83578869-83578891 CTGGTTCTTTCTCCTCTGGGAGG + Intergenic
1071371476 10:84955922-84955944 CCGATTCTGTTTTCTCTGCCTGG + Intergenic
1071983851 10:91031323-91031345 CTGCTTCTGTGGCCTCTGGCAGG + Intergenic
1072242371 10:93508671-93508693 CTCTTTCTGTTCCCTCTGCCTGG + Intronic
1072448196 10:95517625-95517647 CTGGTACTTTGTCCTGTGCCTGG + Intronic
1073478125 10:103767631-103767653 CTGGTTCTGTTTCCACAGCACGG - Intronic
1074188558 10:111116695-111116717 CCCGGTCTCTGTCCTCTGCCGGG + Intergenic
1074690572 10:116000622-116000644 CTTGTTCAGTGTCTTCTTCCAGG + Intergenic
1076015854 10:127027237-127027259 CAGGTTCTGTGTGCTCTGGATGG + Intronic
1077160247 11:1109430-1109452 CTGGCTGTGTGTACTCTGCCGGG + Intergenic
1077164331 11:1128520-1128542 CTGATGCTGTGACCTCAGCCAGG + Intergenic
1077207126 11:1350044-1350066 CTGGACCTGGCTCCTCTGCCTGG + Intergenic
1077516307 11:3004015-3004037 CTGCTTCTGAGCACTCTGCCAGG + Intronic
1077644258 11:3909444-3909466 CTGCTTCTGCTTCCTCTGCCTGG - Intronic
1078390694 11:10933092-10933114 CTGCCTCTGTGGCCTCTGCCTGG - Intergenic
1078599582 11:12718273-12718295 CTGGTTGTGGGACCTCTGGCAGG + Intronic
1079104328 11:17560814-17560836 CTTGGTCTGTGTCTGCTGCCGGG + Exonic
1079139171 11:17796295-17796317 CAGTGCCTGTGTCCTCTGCCAGG - Intronic
1079763199 11:24356687-24356709 CTGGTGCTGTATCCACTGCTGGG - Intergenic
1080515732 11:33017702-33017724 CTCTTTCTGTGTGCTCTGGCAGG + Intronic
1081580645 11:44349320-44349342 CTGTTTCTGTGGCCTGTGCAGGG + Intergenic
1081665963 11:44917289-44917311 CAGGCTCTGTTACCTCTGCCAGG - Intronic
1081736067 11:45405170-45405192 CTGATGCTGTACCCTCTGCCTGG - Intergenic
1081760972 11:45576310-45576332 CTTGTGCTGTGTCCTCCACCTGG - Intergenic
1083108178 11:60378629-60378651 CTGGTCCTGTGTGCTGTGGCTGG - Exonic
1083722728 11:64611454-64611476 CTGGTCCTGTGCCCTGGGCCTGG - Intronic
1083727404 11:64635833-64635855 TTGGATCTGTCACCTCTGCCAGG - Intronic
1083896023 11:65620221-65620243 CTTGTGCTGTGTCCTCTGAGAGG - Intronic
1085043821 11:73342259-73342281 CTTGTCCTGTGTCCTATACCTGG - Intronic
1085450485 11:76629297-76629319 CTGGCTCTGTGTCCTGTGCCAGG + Intergenic
1087775338 11:102251692-102251714 CTCATTCTGTTCCCTCTGCCTGG + Intergenic
1088976024 11:114817226-114817248 CTGCTGCTGTGGCCTCTGCCTGG - Intergenic
1089342307 11:117766616-117766638 CTTGCTCTGTGTCCACCGCCAGG + Intronic
1089413822 11:118270031-118270053 CCTGTACTGTTTCCTCTGCCCGG - Intergenic
1089618816 11:119710663-119710685 CTGTTCCTGTCTCCTCTGCCTGG - Intronic
1089934942 11:122354807-122354829 CTGCTTCCCTGTCCTCTGTCTGG + Intergenic
1090645886 11:128766349-128766371 CTGGTTTTTGGTTCTCTGCCTGG + Intronic
1090665717 11:128913894-128913916 CTGGGTCTGAGTCCCCTGCCCGG - Intronic
1090851510 11:130574876-130574898 CGGGTTTTCTGTCCTCTGCATGG + Intergenic
1091492215 12:942926-942948 CTGGTTACCTGTCCTCTGTCTGG - Intronic
1092126631 12:6079295-6079317 CTGTTTCTGTGTCCTGTCTCAGG - Intronic
1092180795 12:6445363-6445385 CTGGTTCTCTGCCCTCTTCAAGG - Intronic
1095957359 12:47814283-47814305 CTGGTTCTGTCCTCTCTTCCAGG + Intronic
1096523645 12:52198209-52198231 TTGATACTGGGTCCTCTGCCTGG + Intergenic
1096523779 12:52198780-52198802 TTGCATCTGTGTCCTCTCCCAGG + Intergenic
1096529879 12:52235850-52235872 TTGGCTCTGTGTCCTCTCCTAGG - Intronic
1098394853 12:70006447-70006469 CTGGTTCTGTGTGCCCTAGCAGG + Intergenic
1099752697 12:86798309-86798331 TTTGTTTTGTCTCCTCTGCCAGG + Intronic
1099927348 12:89033688-89033710 CTGATTCTGTCTACTCAGCCTGG - Intergenic
1100743300 12:97618882-97618904 CTCCTACTGTTTCCTCTGCCTGG + Intergenic
1101295781 12:103422508-103422530 GTGGTTCTGAGTCCCCTGCTGGG + Intronic
1101368619 12:104102022-104102044 CTGAATCTGTATCCTGTGCCTGG - Exonic
1101737144 12:107471663-107471685 CTGCTTCTGTGTCTCTTGCCAGG - Intronic
1101910351 12:108856808-108856830 CTGGTTCTGAGACCTGTGGCCGG - Intronic
1102034226 12:109761722-109761744 CTGGGTGTGGGTACTCTGCCTGG + Intronic
1102177898 12:110889507-110889529 CTGTTGCTGTTTCCTCTGCCTGG - Intronic
1102200331 12:111053586-111053608 CATTTTCTGTTTCCTCTGCCTGG + Intronic
1103361773 12:120358879-120358901 CAGGATCTGCGTCCTCTCCCAGG - Intronic
1103721883 12:122979634-122979656 GTGGTACTGTGGGCTCTGCCTGG - Exonic
1104515596 12:129423110-129423132 ATTGTTCTGTGTACTCTTCCAGG - Intronic
1104593009 12:130099675-130099697 CTGGCTCTGTGGCCTCTGATAGG + Intergenic
1104598265 12:130134504-130134526 CGGGTTCTGCTCCCTCTGCCTGG + Intergenic
1104779777 12:131412676-131412698 CTGGCTCTGTGTGCTCTTCTAGG - Intergenic
1105282903 13:18979471-18979493 CACATGCTGTGTCCTCTGCCTGG + Intergenic
1108254041 13:48593769-48593791 CTTGGTGTGTGTCCACTGCCTGG + Intergenic
1108453090 13:50586810-50586832 CTGGTTCTCTGCCCTGTGCGGGG + Intronic
1110564821 13:76947490-76947512 CTGATTCTTGATCCTCTGCCTGG - Intergenic
1111954260 13:94739889-94739911 CTGTTGCTGTGTCCTCTGGAAGG + Intergenic
1113089479 13:106602295-106602317 CTGTTTCTGTTCCCTGTGCCTGG + Intergenic
1113845995 13:113391965-113391987 CTGTTTCTGTGTCTTCTGAGAGG - Intergenic
1113867764 13:113539199-113539221 CTGGTCCTGGGTCGTCTGCTGGG - Intronic
1113923129 13:113925570-113925592 CCTGTTCTGTTCCCTCTGCCTGG + Intergenic
1114053464 14:18943671-18943693 CTGGTGCTGTGTTCACTGCCTGG - Intergenic
1114055031 14:18960596-18960618 CTGGCGCTGTGTTCACTGCCTGG - Intergenic
1114107510 14:19441182-19441204 CTGGTGCTGTGTTCACTGCCTGG + Intergenic
1114109095 14:19458254-19458276 CTGGTGCTGTGTTCACTGCCTGG + Intergenic
1114261063 14:21036683-21036705 CTGCTGCTGTCTCCTCTACCTGG + Intronic
1114647688 14:24264602-24264624 CTGGTTCTCTGGGATCTGCCTGG - Intergenic
1118106863 14:62669608-62669630 TTGCTTCTGTGTCTTATGCCTGG - Intergenic
1118521887 14:66595439-66595461 CTTGTTCTGCCTACTCTGCCTGG + Intronic
1118885129 14:69859781-69859803 CTGGTTCTGTGCCAGCTGCTGGG + Intronic
1119324980 14:73754505-73754527 CTGCTCCTGTGTCCTGCGCCTGG - Intronic
1119444510 14:74652257-74652279 CTTGTTCTGTGCACTCTGCAAGG - Intergenic
1119495212 14:75071851-75071873 CTAGTTCTGTGCCCTTAGCCCGG - Exonic
1119776168 14:77250168-77250190 CAGGCTCTGTTTCCTCTTCCAGG - Intronic
1120860968 14:89254692-89254714 ATCAATCTGTGTCCTCTGCCTGG + Intronic
1121922781 14:97898530-97898552 CTGCTGCTGTTGCCTCTGCCAGG - Intergenic
1122035988 14:98949810-98949832 CAGGTTCTGTCTCTTCAGCCTGG - Intergenic
1122059175 14:99125125-99125147 CTGCTCCTGTGTTCTCAGCCTGG - Intergenic
1122552239 14:102556334-102556356 CAGGTTCGCTGTCCTCAGCCAGG - Intergenic
1122728528 14:103777427-103777449 TTGGTTCTGGATCCTCTGTCAGG - Intronic
1122761687 14:104033419-104033441 CTGTTTCTGTATCTCCTGCCAGG - Intronic
1122800026 14:104224824-104224846 CTGCTGCTCTGTCCCCTGCCTGG - Intergenic
1122907905 14:104810637-104810659 CTGGGTCTGTGGCCTTTCCCAGG + Intergenic
1123157150 14:106238418-106238440 CTGTTTGTGTTTCCTCTGCTAGG - Intergenic
1124476112 15:30036116-30036138 CTCTTTATGTTTCCTCTGCCAGG + Intergenic
1125413662 15:39430453-39430475 CTTGTCCTGTTGCCTCTGCCTGG + Intergenic
1127003212 15:54534474-54534496 CTGGTTCTTTCTCATCTGCATGG - Intronic
1127310658 15:57749065-57749087 CTAGTTCTGTGACCTTAGCCAGG - Intronic
1127443095 15:59031484-59031506 TTGTTTCTGTGTCCTCTGTGAGG - Exonic
1128669642 15:69565578-69565600 CTGGTTCTGCTCCCTCTGCTTGG + Intergenic
1129410759 15:75349077-75349099 CTGATACTGAGCCCTCTGCCTGG + Exonic
1129666222 15:77580919-77580941 ACTGTTCTCTGTCCTCTGCCAGG + Intergenic
1129797473 15:78389136-78389158 CTGCTTCTTTGTCCACTTCCTGG + Intergenic
1130045460 15:80440729-80440751 CAGGTCCTGTCTCCTCTGGCTGG - Intronic
1131059029 15:89393090-89393112 CTGCTTCCGGGTCCTCTTCCAGG - Intergenic
1131830919 15:96354130-96354152 GTGGGTGTGTGTCCTCTTCCAGG - Intergenic
1131864140 15:96689077-96689099 CTTGTGCTGTTTCTTCTGCCTGG + Intergenic
1132748529 16:1446907-1446929 GTGCTTCCGTGTCCCCTGCCGGG + Intronic
1133143875 16:3769209-3769231 CGGGCTCAGTGTCCTCTGCTTGG + Exonic
1135732620 16:24907342-24907364 ATGGTTATGTGCCCTGTGCCTGG - Intronic
1138280595 16:55769916-55769938 CTGGCTCTGTGTCCTGTAACTGG + Intergenic
1138287891 16:55823707-55823729 CTGGCTCTGTGTCCTGTAACTGG - Intronic
1138629723 16:58283712-58283734 TTTGTACTGGGTCCTCTGCCAGG - Exonic
1138776592 16:59730355-59730377 CTGGTTCTTTGTCATCTGTGTGG - Intronic
1139367997 16:66445625-66445647 CTGATTCAGAATCCTCTGCCTGG - Intronic
1139432147 16:66916545-66916567 CTGGCTGTGTGACCTCTGACAGG - Intronic
1140056694 16:71531648-71531670 CCAGTTCTGTGTCCTGTGCGGGG - Intronic
1140832554 16:78765206-78765228 CTCGTGCTGGATCCTCTGCCAGG - Intronic
1141338478 16:83179699-83179721 CTGGTTCTGTGACTTCAGGCAGG - Intronic
1141571114 16:84934157-84934179 CTTGTTCTGTTTCCTTTGCCCGG + Intergenic
1142191645 16:88720900-88720922 CTGGGGCTGTGTCCTCTGTCTGG + Intronic
1142212591 16:88815599-88815621 TTGGTTCTGTGTCCCCATCCAGG + Intronic
1142245517 16:88968433-88968455 CTGGCTCTGTCCCCACTGCCAGG - Intronic
1142317545 16:89357621-89357643 CTGCTTCTCTGTCATCCGCCAGG - Intronic
1142862773 17:2773430-2773452 GTGGCTCTGTGTCATCTGCAAGG - Intergenic
1143347791 17:6262568-6262590 CTGGTGCTGTCACCTCTGCCAGG - Intergenic
1143833266 17:9669772-9669794 CCTGTGCTGTGTCCTCTGCCTGG - Intronic
1144520061 17:15947319-15947341 CTGGGTCTCTGGTCTCTGCCAGG - Intronic
1144714210 17:17422863-17422885 CTGGCTGACTGTCCTCTGCCAGG - Intergenic
1145062636 17:19742629-19742651 CTGGCTCGGTGTGCTCTGCAGGG - Exonic
1145480149 17:23670858-23670880 CTGTTTCTGTGGCATCTGCAAGG + Intergenic
1145504768 17:24029305-24029327 CTCTTTCTGTGTCATCTGCAAGG + Intergenic
1145516435 17:24198780-24198802 CTGTTTCTGTGGCATCTGCAAGG + Intergenic
1145516941 17:24206078-24206100 CTGTTTCTGTGGCATCTGCAAGG + Intergenic
1145522455 17:24286341-24286363 CTGTTTCTGTGGCATCTGCAAGG + Intergenic
1145566909 17:24932947-24932969 CTGTTTCTGTGGCTTCTGCAAGG + Intergenic
1145573226 17:25024868-25024890 CTGTTTCTGTGGCATCTGCAAGG + Intergenic
1145581124 17:25139722-25139744 CTGTTTCTGTGGCATCTGCAAGG + Intergenic
1145598467 17:25392185-25392207 CTGTTTCTGTGGCATCTGCAAGG + Intergenic
1145608850 17:25543546-25543568 CTGTTTCTGTGGCATCTGCAAGG + Intergenic
1145619181 17:25694447-25694469 CTGTTTCTGTGGCATCTGCAAGG + Intergenic
1145630746 17:25862558-25862580 CTGTTTCTGTGGCATCTGCAAGG + Intergenic
1145632196 17:25883601-25883623 CTCTTTCTGTGTCATCTGCAAGG + Intergenic
1145634920 17:25922495-25922517 CTGTTTCTGTGGCATCTGCAAGG + Intergenic
1145640684 17:26005992-26006014 CTGTTTCTGTGGCATCTGCATGG + Intergenic
1145643228 17:26043148-26043170 CTGTTTCTGTGGCATCTGCAAGG + Intergenic
1145643587 17:26048416-26048438 CTGTTTCTGTGGCATCTGCAAGG + Intergenic
1145650753 17:26152585-26152607 CTGTTTCTGTGGCATCTGCAAGG + Intergenic
1145655991 17:26228269-26228291 CTGTTTCTGTGGCATCTGCAAGG + Intergenic
1145657662 17:26252527-26252549 CTGTTTCTGTGGCATCTGCAAGG + Intergenic
1145665805 17:26371005-26371027 CTGTTTCTGTGGCATCTGCAAGG + Intergenic
1145671523 17:26454011-26454033 CTGTTTCTGTGGCATCTGCAAGG + Intergenic
1145781082 17:27563751-27563773 TATGTTCTGTTTCCTCTGCCTGG + Intronic
1146470465 17:33120476-33120498 CTGCCTCTGTGTCATCTGCCAGG - Intronic
1146502398 17:33375299-33375321 CATGTGCTGTTTCCTCTGCCGGG - Intronic
1146930621 17:36775000-36775022 CTTGTGCTGTGTCTTCTGCCTGG - Intergenic
1146939610 17:36835443-36835465 CACTTGCTGTGTCCTCTGCCTGG - Intergenic
1147727736 17:42577302-42577324 CTCCTTCTCTCTCCTCTGCCAGG - Exonic
1148063279 17:44851065-44851087 TTCCTTCTGTGGCCTCTGCCGGG - Exonic
1148080627 17:44966198-44966220 CTTCTTCTCTTTCCTCTGCCTGG - Intronic
1148549546 17:48542377-48542399 GTGGTTCTGGGGCCTCTGCTTGG - Intronic
1148777686 17:50104852-50104874 CCCGTGCTGTCTCCTCTGCCGGG + Intronic
1148926432 17:51090069-51090091 CATGTGCTGTGACCTCTGCCTGG - Intronic
1149300435 17:55300374-55300396 CTTGTTCTGTGTGCTCTCCTGGG + Intronic
1149599015 17:57881452-57881474 CTGGGTCACTGTCCTGTGCCAGG - Intronic
1150452298 17:65279080-65279102 CTGGTTTTGTGACCTCTGGCAGG - Intergenic
1151692629 17:75696154-75696176 CTGGGTCTGTGGCTGCTGCCTGG - Intronic
1152286189 17:79414618-79414640 CTGTTTCTGAGTCCGCAGCCTGG - Intronic
1152770568 17:82165710-82165732 CTGGTTCTGTGGATTCTGGCTGG - Intronic
1153003925 18:480788-480810 CTGCTTCTGTGCCCCTTGCCAGG - Intronic
1154499760 18:14990070-14990092 CTGCTCCTGTTTCCTCAGCCTGG - Intergenic
1156425194 18:37003437-37003459 CTGGATATGAGTCCCCTGCCAGG - Intronic
1156674875 18:39515359-39515381 CTGATTCTCTTTCCTCTGCTTGG + Intergenic
1157328272 18:46684969-46684991 CAGGTCCTGTTCCCTCTGCCTGG - Intronic
1158360910 18:56672045-56672067 CTAGTTCTGTGTCCTAGGGCAGG + Intronic
1158864015 18:61619847-61619869 CTGGGTCTCTGTCCTTTGTCTGG + Intergenic
1160232065 18:77056176-77056198 CTGTTGCTGTCTCCTGTGCCTGG + Intronic
1161261890 19:3342368-3342390 TGGGCTCTCTGTCCTCTGCCTGG - Intergenic
1161294632 19:3513421-3513443 CTGGCTCTGTGCCCACTCCCTGG - Intronic
1161618741 19:5287168-5287190 CTTCTGCTGTGCCCTCTGCCTGG + Intronic
1161684209 19:5695088-5695110 CTTGTGCTGCGTCCTCTGCTTGG + Intronic
1161718669 19:5891708-5891730 CTGTTGCTGTGTGCTCTGCCTGG + Exonic
1161774079 19:6248430-6248452 CTGGTTAAGTGGCATCTGCCAGG - Intronic
1162027256 19:7901342-7901364 CTGTGTCTGTGTCCTCTCCTTGG - Exonic
1162855319 19:13463567-13463589 CTGGTTTTGTTTTCTCTCCCCGG - Intronic
1163128521 19:15257601-15257623 CGTGTGCTGTGTCCTCTGCCTGG - Intronic
1163338407 19:16688390-16688412 CTGGGTCCGGGTCCTCTCCCCGG - Exonic
1163422103 19:17219515-17219537 CTGGTGCTGTGCCCTCTGCTGGG - Intronic
1163573987 19:18099728-18099750 CACGTGCTGTGGCCTCTGCCCGG - Intronic
1165075772 19:33279120-33279142 CTGCTTCTCAGTCCCCTGCCAGG - Intergenic
1165388237 19:35524277-35524299 CTGTGTCTTTGTCCTCTCCCTGG - Intronic
1165795981 19:38519383-38519405 CGAGTTCTCTGTGCTCTGCCGGG + Exonic
1166083801 19:40461861-40461883 CACGTGCTGTGCCCTCTGCCTGG + Intronic
1166540761 19:43604098-43604120 CTGGCTTTGTGACCTCTGGCAGG + Intronic
1167269724 19:48499974-48499996 CTGGTTGTCTGTCCCCTCCCTGG - Intronic
1167348847 19:48962878-48962900 CTGGGTCTCTGTCCTCTCTCTGG + Intergenic
1167852703 19:52214146-52214168 AGGGTTCTTTGTCCTCTGGCTGG - Intronic
1168161421 19:54512897-54512919 CTGCTTTTCTGTCCTCTGCCTGG - Intergenic
1168311135 19:55461404-55461426 CTGGTCCTGTGACCTTGGCCCGG + Intronic
1168403791 19:56100492-56100514 CTGGTTCCCTTTTCTCTGCCTGG + Intronic
1168486626 19:56768079-56768101 CTCATGCTGTTTCCTCTGCCCGG + Intergenic
925008876 2:467408-467430 CTGGCTCTGTGGCCCCTGCATGG + Intergenic
925331532 2:3062542-3062564 CTGGTTCTGTGCACTCAGGCTGG + Intergenic
925452377 2:3980629-3980651 TTTTTTCTGTGTCCACTGCCCGG + Intergenic
925757631 2:7148945-7148967 CTGATGAAGTGTCCTCTGCCTGG - Intergenic
926207465 2:10844254-10844276 CTCCTGCTGTATCCTCTGCCAGG - Intergenic
926683212 2:15679691-15679713 CTCATACTGTTTCCTCTGCCTGG + Intergenic
927152175 2:20202573-20202595 CTGCTTCTCTGACTTCTGCCTGG - Exonic
927254913 2:21032641-21032663 CTCATGGTGTGTCCTCTGCCAGG + Intronic
927502918 2:23594153-23594175 AAGGTTCTGTTTTCTCTGCCTGG + Intronic
927841640 2:26448849-26448871 CAGGTTCTGAGGCCTCTGCTGGG + Intronic
929124209 2:38508659-38508681 CTGGCTCTGAGCCCTTTGCCTGG - Intergenic
930526307 2:52534897-52534919 TTGGTTGTGTCTTCTCTGCCCGG + Intergenic
931789537 2:65652336-65652358 CATGTGCTGTATCCTCTGCCTGG + Intergenic
932302711 2:70678438-70678460 CTGGTTCTGGGTCATGTGCCTGG + Intronic
932567640 2:72919674-72919696 CTGGTTTTGTGGTATCTGCCAGG - Intronic
932818344 2:74879243-74879265 CAGGTGCTATGTCCTCTGCCAGG + Intronic
933761427 2:85674892-85674914 CTGATTCTGTGGCCTCACCCTGG + Intergenic
934558778 2:95301469-95301491 CTGGCTGTGTGTCCTCTGACAGG + Intronic
934912911 2:98275631-98275653 CTGGTGCTGTGCACTCTCCCAGG - Intronic
935410109 2:102752511-102752533 CTGGGACAGTGGCCTCTGCCTGG + Intronic
935483892 2:103628981-103629003 CTGGTTCTAAGTCCTGTTCCAGG + Intergenic
935555830 2:104508687-104508709 CAGGTTCTGTGTCTGCAGCCTGG - Intergenic
935712207 2:105909297-105909319 CTTTCTCTGTGTCCTCTACCGGG - Intergenic
936452063 2:112641264-112641286 GTGCTTCTGTTCCCTCTGCCTGG + Intergenic
937259471 2:120576387-120576409 CTGCTTCTGTTTCTTCTTCCAGG - Intergenic
938131364 2:128718317-128718339 CTGGTTCAGTGCCCTGTCCCTGG + Intergenic
938255847 2:129859090-129859112 CTGTTTCTTTGACCTCTACCAGG - Intergenic
938471429 2:131566170-131566192 CTGGTGCTGTGTTCACCGCCTGG - Intergenic
938473042 2:131583383-131583405 CTGGTGCTGTGTTCACCGCCTGG - Intergenic
939111314 2:138011183-138011205 TTGGTTCTTTTTTCTCTGCCAGG + Intronic
939912941 2:148005567-148005589 CTTGTTCTGCCTCCTCTGCAAGG - Intronic
940031843 2:149271967-149271989 ATGGTGCTGTTTCCTCTGCCTGG + Intergenic
942556297 2:177175548-177175570 CTGAGACTGTGCCCTCTGCCTGG + Intergenic
943947501 2:194086839-194086861 GTGGTTCTGTGTTCTTTTCCTGG + Intergenic
945252791 2:207778479-207778501 CTGGCTCTATGCCCTTTGCCTGG - Intergenic
946142098 2:217700188-217700210 CTTGTTCTGTATCTTGTGCCAGG - Intronic
946415362 2:219537420-219537442 CAGGTTCAGGGTTCTCTGCCAGG + Intronic
946499794 2:220235542-220235564 CCGGTTCTGTGTCTCCTCCCTGG - Intergenic
947767988 2:232649643-232649665 CTGGGCCTGTGTCCTGTGCAAGG + Intronic
948704228 2:239779226-239779248 CTGAGTCTGTGCCATCTGCCTGG + Intronic
948734585 2:239993498-239993520 CTGGTTCTGCGTCTTCTACCAGG - Intronic
1168847772 20:957134-957156 CTGGTCCTCTGTCCTCAGCTGGG - Intergenic
1169218517 20:3807189-3807211 CTGGTTCAGAGCCCTCTGCAAGG + Intergenic
1170601696 20:17846298-17846320 ATGGTTCTGGGGCCTCTGGCAGG + Intergenic
1170742676 20:19071836-19071858 CTGGTTTTGTGTCCTATCCAAGG + Intergenic
1170970517 20:21111967-21111989 CTACTTCTCTGTCTTCTGCCAGG + Intergenic
1171187886 20:23136594-23136616 CTGGTTGTGCGGCCTCTGGCTGG - Intergenic
1171298179 20:24037023-24037045 CTGCTTCTCTGTGCTCTGCAGGG - Intergenic
1172067844 20:32234211-32234233 CTTGTGCTGTTCCCTCTGCCTGG - Intronic
1172911859 20:38415480-38415502 CTGGTACTGTGGCCCCTGCTAGG + Intergenic
1173337232 20:42122637-42122659 TTGGTGCTGTGGCCTCAGCCAGG - Intronic
1173970991 20:47152192-47152214 CTGGTTCTGCAACCTCAGCCGGG + Intronic
1174013416 20:47469098-47469120 CTTGTTCTGTCTCCTATGTCTGG + Intergenic
1174354335 20:49988219-49988241 CTGGTTCTGTGTCCTCTGCCTGG + Exonic
1174406578 20:50306838-50306860 CCCGTGCTGTTTCCTCTGCCAGG + Intergenic
1174545568 20:51322579-51322601 CTCCTGCTGTGTCCTCTGCCGGG + Intergenic
1174572508 20:51512128-51512150 CTGGTTCTATGACCTGTTCCAGG + Intronic
1174872738 20:54198794-54198816 TTGTTGCTGTGTCCTCTGCAGGG + Intergenic
1175243752 20:57568692-57568714 CTGGCTCGGTGCCCTCTGGCAGG - Intergenic
1175404601 20:58718025-58718047 CTGCATCTGGGTCCTCTCCCAGG - Intronic
1175464073 20:59177898-59177920 CTGTTTCTGTGGCTTCTGCAAGG - Intergenic
1175760736 20:61560862-61560884 CTGGTTCCATGTCCGCTGGCTGG - Intronic
1177825990 21:26083964-26083986 CTGGTATTGTGTCCTCTTTCTGG - Intronic
1178226328 21:30723605-30723627 CTAATTCTATATCCTCTGCCTGG + Intergenic
1178584331 21:33859957-33859979 CTGGCTGTGTGTCTTCTGGCAGG + Intronic
1178764736 21:35439752-35439774 CCTGCTCTGTGTCCACTGCCGGG - Intronic
1179164594 21:38925659-38925681 CTGGCTCTGCCTCCTCTGCTGGG - Intergenic
1179546499 21:42115639-42115661 CTGGCTCTGTGGCCTCTGGAAGG + Intronic
1179577246 21:42315624-42315646 CTGGTTCCGGGTCCTCTACTGGG + Exonic
1180172487 21:46067051-46067073 CTGGCCCTGTGTCCTGGGCCTGG - Intergenic
1180471933 22:15666052-15666074 CTGGTGCTGTGTTCACTGCCTGG - Intergenic
1180473512 22:15683146-15683168 CTGGTGCTGTGTTCACTGCCTGG - Intergenic
1180915587 22:19484158-19484180 CTGGTTATGTGGCCTCAGGCAGG + Intronic
1181005709 22:20012546-20012568 CTGGTACTGGGTCCTTGGCCAGG - Intronic
1181714384 22:24713538-24713560 CGGGTTCTTTGACCACTGCCTGG - Intergenic
1181768676 22:25110664-25110686 CAGGTTTTCTGTCCTCTGCCTGG - Intronic
1181768870 22:25111586-25111608 CAGGTTTTCTGTCCTCTGGCTGG - Intronic
1182280272 22:29214393-29214415 CTGGTGCTGGGCCCTCTGCCTGG - Intronic
1182371167 22:29812105-29812127 CTGGTGCTGTGACCCCTCCCTGG - Intronic
1182813147 22:33134962-33134984 CTGGGGCTGGGTCATCTGCCTGG + Intergenic
1183421280 22:37713188-37713210 TTGGGTCTGTCTCCTCTCCCAGG + Exonic
1183483746 22:38078429-38078451 CTGGTTCTGTGGGCTCGCCCCGG + Exonic
1183922613 22:41181497-41181519 CTGTTCATGTGTGCTCTGCCTGG - Intergenic
1184191177 22:42895741-42895763 CTGGTCCTGTGACCACTGCTGGG + Intronic
1184353758 22:43964198-43964220 CTGGTCCTGGGTCATCTGGCTGG + Intronic
1184550650 22:45202659-45202681 CTGGCTCTGTGGACTCAGCCTGG + Intronic
950031290 3:9855551-9855573 CTGGTTTTGAGTCCTCTTCTGGG - Intergenic
950047969 3:9962109-9962131 CTGATTCTGTTTTCTCTGCTTGG + Intergenic
950073194 3:10168827-10168849 CAGGTGCTGTTCCCTCTGCCTGG + Intronic
950100564 3:10354053-10354075 CTCATTCTGTCCCCTCTGCCTGG + Intronic
950401683 3:12773922-12773944 ATGGTCCTGTGACATCTGCCTGG - Intergenic
950563033 3:13746834-13746856 CTGGGCCTGGGTCCTCTGCCAGG - Intergenic
950655070 3:14431521-14431543 CTTGTGCTGTGCCCTCAGCCCGG - Intronic
950666319 3:14497471-14497493 CACGTGCTGTTTCCTCTGCCAGG - Intronic
950898144 3:16472499-16472521 CAGGTTTTCTGTCCTCTTCCTGG - Intronic
952530516 3:34257831-34257853 ATGGCACTGTGTCCTCTGTCTGG - Intergenic
953747060 3:45583228-45583250 CTGTGTGTGTGGCCTCTGCCAGG - Intronic
954382072 3:50224831-50224853 CTGGTTCTGCCTCATCTTCCAGG - Intergenic
954408996 3:50361585-50361607 CTTTTTCTGTCTCCTCTGCAGGG - Intronic
954911450 3:54114201-54114223 CTTGTGTTGTGCCCTCTGCCTGG - Intergenic
954985762 3:54790265-54790287 CTGGTGCGGTGTCCTCTCCTAGG + Intronic
955373451 3:58373706-58373728 TATGTTCTGTTTCCTCTGCCTGG + Intronic
955409352 3:58645818-58645840 CTGGTCCTGTGTGCTCTGGTGGG - Intronic
956726147 3:72158088-72158110 CACGAGCTGTGTCCTCTGCCTGG - Intergenic
957156360 3:76550491-76550513 CTGGGACTGTGTGCTCTGCAGGG + Intronic
957168588 3:76708329-76708351 GTGCTTCTGTTCCCTCTGCCAGG - Intronic
959340084 3:105118103-105118125 CTGGGTCTATGTTCTCTACCAGG + Intergenic
959535726 3:107482899-107482921 CTGGTTGTGTGTCCCCGGCATGG + Intergenic
961593481 3:127998234-127998256 CTCGATCTCTGCCCTCTGCCTGG - Intergenic
962324664 3:134423212-134423234 CTGGCTCTGTCCCATCTGCCTGG + Intergenic
962369207 3:134806756-134806778 CTGGTTTTGTGCCTACTGCCTGG - Intronic
962878725 3:139556028-139556050 CAGGTGCTGTTCCCTCTGCCTGG - Intergenic
962922869 3:139966450-139966472 CTGATGCGGTTTCCTCTGCCTGG + Intronic
963839172 3:150087672-150087694 CTGGATTTGAGTCCTCTGTCAGG - Intergenic
964138990 3:153376691-153376713 TTGGTTCTGTGTCCTCGGCTAGG - Intergenic
964933455 3:162052598-162052620 CTGGTGCTGTGGCCTAGGCCTGG - Intergenic
965313409 3:167160103-167160125 CTGGTTCTGTGGCCTTAGACAGG + Intergenic
966351614 3:179037560-179037582 TGGGTGCTGTGTCCTCTGCCTGG - Intronic
967286728 3:187878621-187878643 CTTGTGCTCTGTCCTGTGCCTGG + Intergenic
967876988 3:194274133-194274155 CCAGTGCTGTGCCCTCTGCCTGG + Intergenic
967923949 3:194632356-194632378 CTGGTCCTTTCTCCCCTGCCAGG + Intronic
968459884 4:719510-719532 CAGGTCCTGTGTCCTCCGCGCGG + Intronic
968516074 4:1016164-1016186 CTGATGCTCTGTCCCCTGCCAGG - Intronic
968648801 4:1752383-1752405 CAGGTGCTGGCTCCTCTGCCAGG + Intergenic
968898747 4:3420684-3420706 AGGGCTCTGTGTCCTCTGCGGGG + Exonic
968958646 4:3731562-3731584 CTGGCCCTGTGACCTCTGCCTGG + Intergenic
969342426 4:6550479-6550501 CACGTGCTGTTTCCTCTGCCGGG + Intronic
971044847 4:22794006-22794028 CATTTTCTGTTTCCTCTGCCTGG + Intergenic
971994138 4:33942456-33942478 CAGGTTCTGTGTACTCAGACTGG + Intergenic
972573163 4:40328965-40328987 CTCCTTCTGTTCCCTCTGCCTGG - Intergenic
972741843 4:41894277-41894299 CTGGCACTGTGCCCACTGCCTGG - Intergenic
976681476 4:87760987-87761009 CTGGTGGTGTGTCCTCTTCAAGG + Intergenic
977526885 4:98157021-98157043 CTGGTACTGTCTCTTCTGGCAGG + Intergenic
979963614 4:127050903-127050925 CTGGTCCTCTGTCCTCTCCGTGG + Intergenic
980665752 4:135931847-135931869 CATGTGCTGTGTCGTCTGCCTGG + Intergenic
981277947 4:142923480-142923502 CTGGTGCTGTGCCCTTTGCATGG - Intergenic
981627531 4:146776376-146776398 CTGGTTCTGTCTCATCTGTGTGG + Intronic
982348125 4:154384382-154384404 CTGGTTTTGCGTTCTCTTCCTGG + Exonic
983566493 4:169158330-169158352 CTGGTGCTGACCCCTCTGCCTGG - Intronic
983730380 4:170985973-170985995 CAGGTACTATGCCCTCTGCCTGG - Intergenic
984531059 4:180916759-180916781 CTGGTTTACTGTCCTATGCCAGG - Intergenic
984857065 4:184204488-184204510 CTGGTTCTGAATCATGTGCCTGG + Intronic
985704248 5:1391441-1391463 CTGGGTGGGTCTCCTCTGCCAGG - Intergenic
986013886 5:3740762-3740784 CCTCTTCTGTGTCCTCAGCCCGG + Intergenic
987060930 5:14243170-14243192 CTGCTTCTGTGTCCCCTCTCCGG + Intronic
987946394 5:24614656-24614678 CTGGTTCTGTTTACTCGGTCTGG - Intronic
987974178 5:24991176-24991198 CTGGTTCTTTCTCATCTGTCTGG - Intergenic
989265997 5:39474876-39474898 CAGGTGCTGGTTCCTCTGCCTGG - Intergenic
989919175 5:49776590-49776612 CTGTTTCTGTGGAATCTGCCAGG + Intergenic
989935292 5:50015078-50015100 CTGTTTCTGTGGAATCTGCCAGG + Intergenic
990725021 5:58743724-58743746 CTGATGCTGTGTCCTTTGCAGGG - Intronic
992078767 5:73215451-73215473 CTGGTTCAGTGTCCCGTGTCAGG - Intergenic
993186275 5:84625387-84625409 CTGTTTCTGTGTTGGCTGCCAGG + Intergenic
994851396 5:105058254-105058276 CTCATTCTGTGTACTCTGCCTGG - Intergenic
996451458 5:123629776-123629798 CTGGTTCTTTCTCATCTTCCTGG - Intergenic
997674505 5:135702662-135702684 CTGGTGCTGTGTCCTCCTCCTGG + Intergenic
997690957 5:135827223-135827245 CTGGTTTTGTGTCTCCTCCCCGG + Intergenic
999471332 5:151857698-151857720 CTGAGTCTGTGGCCTCTGTCAGG - Intronic
1000007973 5:157204958-157204980 CTGTTTTTGGGTCCTCAGCCCGG - Intronic
1000692108 5:164336997-164337019 GTGGTTCTGTCCTCTCTGCCAGG - Intergenic
1001054415 5:168437112-168437134 CACTTGCTGTGTCCTCTGCCTGG + Intronic
1001628444 5:173156608-173156630 CTCGTTCTGTCTCCTAGGCCAGG - Intronic
1001934718 5:175695879-175695901 CTGGCTCTGTAGCCTCTGACTGG - Intergenic
1002028428 5:176411414-176411436 CAGGTGCTGTTCCCTCTGCCTGG + Intronic
1002470120 5:179430078-179430100 CTGGTTGTTTGCCCTCTGCCTGG + Intergenic
1002951089 6:1812228-1812250 CTGGTCCTGTTTACTCTGCCTGG - Intronic
1004102438 6:12627698-12627720 CTGGTTCACTTTCCTCTTCCTGG + Intergenic
1004276040 6:14235988-14236010 CTGGATCTGTTCTCTCTGCCTGG - Intergenic
1004573497 6:16870574-16870596 CTGCTACTGTCCCCTCTGCCAGG + Intergenic
1005253443 6:23973104-23973126 CTGGTGTTGTGTCCTGTGTCTGG + Intergenic
1007009962 6:38407005-38407027 CTTGTTCTGTTTCCACTACCTGG + Intronic
1007246439 6:40466579-40466601 CTGTATCTTTGTCCTCTGGCGGG - Intronic
1007305498 6:40900845-40900867 CTCGTGCTGTGCCCTCTGCCAGG - Intergenic
1007382914 6:41502360-41502382 CTGTTCCTGTGGACTCTGCCAGG + Intergenic
1007446132 6:41907517-41907539 CTGCTTCTGGGTCCTCTGGGAGG - Intronic
1007502760 6:42311362-42311384 CAGCTGCTGTGTCCTCTGCCTGG - Intronic
1007958606 6:45938919-45938941 TTGGTTCTCTGTCCTCAGCCGGG + Intronic
1009631237 6:66203218-66203240 TGGCTTCTGTGACCTCTGCCTGG - Intergenic
1012417723 6:99027697-99027719 CTCTTGCTGTGCCCTCTGCCTGG - Intergenic
1013050888 6:106533909-106533931 TTGGGACTGTGTCCTGTGCCTGG - Intronic
1013587453 6:111591984-111592006 GTGGTTCTGATTCCTCTTCCGGG + Exonic
1014052833 6:116975859-116975881 CTGGTTCTGTGTACTGGGCTAGG + Intergenic
1014179821 6:118372560-118372582 ATGGCTCTGAGTCATCTGCCTGG + Intergenic
1014872776 6:126616214-126616236 CTGCTTCTGTATTCCCTGCCAGG - Intergenic
1016139222 6:140586889-140586911 CTGGTTATTTGTCATCTGCGTGG - Intergenic
1016658061 6:146543708-146543730 CGGGTTCTGGGTCCTGTGACCGG + Exonic
1017064755 6:150518605-150518627 CTGGGTCTGTCTCCACTTCCTGG + Intergenic
1017159568 6:151352003-151352025 CTGCTTCTGTGCCCCCTGACTGG - Exonic
1017940554 6:159049103-159049125 CTAGTTCTGTGTGCTCTGGGAGG + Intergenic
1017972959 6:159329087-159329109 CTGGAGCTGCGTCCTCGGCCAGG + Intergenic
1018004185 6:159605005-159605027 CAGCTTCTGTCTCCACTGCCAGG + Intergenic
1018169801 6:161135912-161135934 CTGGACCTGTGTCTCCTGCCAGG + Exonic
1018514700 6:164566284-164566306 CTTGTTCTTTTTCTTCTGCCTGG + Intergenic
1018651909 6:165999247-165999269 CTGATGCTCAGTCCTCTGCCAGG + Intergenic
1019515270 7:1437164-1437186 CTGGGCCTGTGCCCTCAGCCAGG + Intronic
1019527353 7:1486760-1486782 CTGCTTCTGTTGCCTCTGCAGGG + Exonic
1019539741 7:1546306-1546328 CTGGTTCTGTGACCCATCCCAGG + Exonic
1020601271 7:10277147-10277169 CTAGTTCTGTGTACTTTGCATGG + Intergenic
1021896418 7:25240203-25240225 CTGGTTCTCTCTTCTGTGCCAGG - Intergenic
1023348582 7:39296613-39296635 CTGGTGGTGTTCCCTCTGCCTGG + Intronic
1024990915 7:55234102-55234124 CGGGTTGTGTATCATCTGCCAGG + Intronic
1026673905 7:72413076-72413098 CTGCCTCTGTGATCTCTGCCAGG - Intronic
1026767762 7:73171339-73171361 CTGCTTCTGTGTCCCCTCCCTGG + Intergenic
1027044229 7:74981047-74981069 CTGCTTCTGTGTCCCCTCCCTGG + Intronic
1027050580 7:75019012-75019034 CAGGTTCTGTGTCACCAGCCTGG + Exonic
1027079413 7:75221311-75221333 CTGCTTCTGTGTCCCCTCCCTGG - Intergenic
1027189135 7:75987816-75987838 CTGCTCCTCTGTCCTCCGCCCGG - Intronic
1028273985 7:88828444-88828466 CTAGTGTTGTTTCCTCTGCCTGG + Intronic
1029382470 7:100222658-100222680 CAGGTTCTGTGTCACCAGCCTGG - Intronic
1029388635 7:100259894-100259916 CTGCTTCTGTGTCCCCTCCCTGG - Intronic
1029480119 7:100807247-100807269 CTGCTCCTGTATCCTCTCCCTGG + Intronic
1031344266 7:120645690-120645712 ATGGTTCTGTGTCCCATGCCTGG + Intronic
1031547360 7:123067571-123067593 CTGGTTCTTTGTCATCTGTGTGG + Intergenic
1031580624 7:123470190-123470212 CTGCTTCTGTTCCCTCTGACAGG + Intronic
1032650290 7:133870727-133870749 CTGAGTCTGTGTTCTCTACCAGG - Intronic
1032695481 7:134332420-134332442 TTTGTGCTGTTTCCTCTGCCTGG + Intergenic
1032708783 7:134444708-134444730 CTGGTTCTGTTTCCTCTGCATGG - Intronic
1033243306 7:139699035-139699057 GTGGTGCTGTGTGCTCTGCGTGG - Intronic
1034150394 7:148910590-148910612 CTGGTTCCCTTTCCTCTGACAGG - Intergenic
1034203451 7:149296354-149296376 TTGTCTGTGTGTCCTCTGCCAGG - Intronic
1035088365 7:156281329-156281351 CTGCTGCTGTGTCCTCTGGAGGG + Intergenic
1035591187 8:815260-815282 CTGTGTCTGTGTCCTCTGAAGGG + Intergenic
1036599911 8:10251037-10251059 CGGGTTCCGTGTGCTGTGCCAGG - Intronic
1037237965 8:16743076-16743098 GTGGCTCTTTGTCCTCTGCTGGG - Intergenic
1038613531 8:29073364-29073386 GTGTGTGTGTGTCCTCTGCCTGG - Intronic
1039640290 8:39212513-39212535 CTGATTCTGTTACCTTTGCCTGG + Intronic
1040387181 8:46921455-46921477 CTGGCAATGTGTCATCTGCCAGG - Intergenic
1041053968 8:53963637-53963659 CTTGTTCTGATTCCTCTCCCTGG - Intergenic
1042321655 8:67481883-67481905 CTGGTACTGTGTCAGCTGCAAGG - Intronic
1042470578 8:69183067-69183089 CTGATTCTGTTTTCTCTGCCTGG - Intergenic
1042810725 8:72822773-72822795 CTAGTTCTCTGACCTCTGGCTGG + Intronic
1045095866 8:98797824-98797846 GTTGTTCTGTGGCATCTGCCTGG - Intronic
1046044610 8:108948792-108948814 CTCATTCTGTTTCCACTGCCTGG + Intergenic
1046215933 8:111147069-111147091 CGGGTACTGTGTTCTCTACCTGG - Intergenic
1046623160 8:116549426-116549448 CTGTTGCTGTGTCCTCTGAAGGG - Intergenic
1047424578 8:124733713-124733735 GTAGTTCTGTGACCTCTGGCAGG - Intergenic
1047765317 8:127985656-127985678 CTGTTTCTGTGTCCTTTTCTGGG + Intergenic
1048304660 8:133275457-133275479 CTTGTGCTGTTACCTCTGCCTGG + Intronic
1048961586 8:139584004-139584026 CTGGTTCTGAGTCCTCCCACAGG + Intergenic
1049647620 8:143742710-143742732 GTGGTTGTGTATCCTCTGGCAGG - Intergenic
1050151506 9:2622607-2622629 ATGGTTCTGCCTCCTCTGCCAGG + Intronic
1052512293 9:29437328-29437350 CTGAGTCTGTGCCCACTGCCAGG - Intergenic
1053132498 9:35624541-35624563 CAGGTTCAGTCACCTCTGCCAGG - Intronic
1053441499 9:38120197-38120219 CCAATTCTGTGTCCTATGCCAGG - Intergenic
1054910786 9:70453418-70453440 CTAATTTTGTCTCCTCTGCCTGG - Intergenic
1054966877 9:71038845-71038867 CAGGTACTGTTTCCTCTGCTTGG - Intronic
1055499025 9:76884977-76884999 CTGTTTCTGTTTCCTCTTACTGG - Intronic
1056397695 9:86196549-86196571 CTTGGCCTGTGTCCACTGCCTGG - Intergenic
1056510680 9:87302035-87302057 CTGGTTTTGTGTCATCTCACTGG - Intergenic
1056985218 9:91357746-91357768 CTTTTCCTGTTTCCTCTGCCTGG - Intronic
1057517245 9:95732241-95732263 CATGTGCTGTGCCCTCTGCCAGG - Intergenic
1057577096 9:96251357-96251379 CAGGTTCTGGGTCCCCTGGCTGG - Intronic
1057582955 9:96303656-96303678 CTGATCCTGTGGCCTCTGCAGGG - Intergenic
1057745547 9:97748186-97748208 CTCATGCTGTTTCCTCTGCCTGG + Intergenic
1057942057 9:99293813-99293835 CTGGTTCTGTGGGCTCTGGGAGG - Intergenic
1058254589 9:102744684-102744706 CTAGCTCTGTATACTCTGCCTGG - Intergenic
1058581945 9:106467850-106467872 CTGTGTCTGTGTCCTTTGCATGG - Intergenic
1059029684 9:110677621-110677643 CGGGTACCGTTTCCTCTGCCTGG + Intronic
1059476139 9:114549431-114549453 CTGGTTATGTATCCTCTCTCAGG - Intergenic
1059567494 9:115397721-115397743 CTCTTGCTTTGTCCTCTGCCTGG - Intronic
1059767173 9:117394660-117394682 CTCGAGCTGTGTCCTCTGTCAGG - Intronic
1061183758 9:129040197-129040219 CAGGTTCTGGGTCCTCTCCTGGG + Intronic
1062400645 9:136371247-136371269 GTGGTGTTGGGTCCTCTGCCTGG - Intronic
1187125272 X:16448662-16448684 CTGTTTCTGTTTCCTTTGCCAGG + Intergenic
1189286161 X:39853912-39853934 ATGCTTCTGTGCCCTCTACCAGG - Intergenic
1189340282 X:40199907-40199929 CTGTTTATGTGTCCTCTTCTTGG - Intergenic
1192311099 X:70014473-70014495 CTGGTTCTTTCTCATCTGCGTGG - Intronic
1192380883 X:70614590-70614612 CTAGTCCTGTGTCCTCTTCAGGG - Intronic
1195500551 X:105593524-105593546 ATGGTTCTGTCTCATCTGCCTGG + Intronic
1195883423 X:109616323-109616345 CATGTTCTGTTTCCTCTGCTTGG - Intergenic
1196586923 X:117440444-117440466 CTGGTTCTTTTTCATCTGCATGG - Intergenic
1196900078 X:120374220-120374242 CTGGTACTGTCTCCACTGGCGGG - Intronic
1198063808 X:133075586-133075608 CTTGTGCTGTTTTCTCTGCCTGG - Intronic
1198932077 X:141872423-141872445 CTGGGTCTCTGTCTTCTGTCTGG - Intronic
1200146908 X:153931053-153931075 CCCGTTCTGTGTCCTTAGCCTGG + Intronic
1200706401 Y:6446431-6446453 ATGGTTTTGGGTCCTCTGACAGG - Intergenic
1201027711 Y:9718277-9718299 ATGGTTTTGGGTCCTCTGACAGG + Intergenic
1201260422 Y:12153690-12153712 CTGGTGCTGTATCCTCAGCCTGG - Intergenic
1201584530 Y:15546252-15546274 CTGGTTCAGAGTCCTGAGCCAGG - Intergenic