ID: 1174356997

View in Genome Browser
Species Human (GRCh38)
Location 20:50005351-50005373
Sequence CCCAAGTCCCAGAGGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174356989_1174356997 0 Left 1174356989 20:50005328-50005350 CCCCATTCAGACAGATGAGGAGG No data
Right 1174356997 20:50005351-50005373 CCCAAGTCCCAGAGGAAGGAGGG No data
1174356988_1174356997 1 Left 1174356988 20:50005327-50005349 CCCCCATTCAGACAGATGAGGAG No data
Right 1174356997 20:50005351-50005373 CCCAAGTCCCAGAGGAAGGAGGG No data
1174356992_1174356997 -2 Left 1174356992 20:50005330-50005352 CCATTCAGACAGATGAGGAGGCC No data
Right 1174356997 20:50005351-50005373 CCCAAGTCCCAGAGGAAGGAGGG No data
1174356991_1174356997 -1 Left 1174356991 20:50005329-50005351 CCCATTCAGACAGATGAGGAGGC No data
Right 1174356997 20:50005351-50005373 CCCAAGTCCCAGAGGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174356997 Original CRISPR CCCAAGTCCCAGAGGAAGGA GGG Intergenic
No off target data available for this crispr