ID: 1174357965

View in Genome Browser
Species Human (GRCh38)
Location 20:50010614-50010636
Sequence CCAGCCCGGAGCTGCCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174357958_1174357965 -5 Left 1174357958 20:50010596-50010618 CCCAGGACCTGCAGGTGCCCAGC No data
Right 1174357965 20:50010614-50010636 CCAGCCCGGAGCTGCCATGGTGG No data
1174357959_1174357965 -6 Left 1174357959 20:50010597-50010619 CCAGGACCTGCAGGTGCCCAGCC No data
Right 1174357965 20:50010614-50010636 CCAGCCCGGAGCTGCCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174357965 Original CRISPR CCAGCCCGGAGCTGCCATGG TGG Intergenic
No off target data available for this crispr