ID: 1174359216

View in Genome Browser
Species Human (GRCh38)
Location 20:50017395-50017417
Sequence CAGCCAATGAGAGACAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174359213_1174359216 1 Left 1174359213 20:50017371-50017393 CCAATCAGGACAACTGCATCCTC No data
Right 1174359216 20:50017395-50017417 CAGCCAATGAGAGACAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174359216 Original CRISPR CAGCCAATGAGAGACAGGCC TGG Intergenic
No off target data available for this crispr