ID: 1174359606

View in Genome Browser
Species Human (GRCh38)
Location 20:50019763-50019785
Sequence CAGTAGTTGCTCAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174359600_1174359606 8 Left 1174359600 20:50019732-50019754 CCAAACAGGGCCACACATGGTGC No data
Right 1174359606 20:50019763-50019785 CAGTAGTTGCTCAGGGAAGAAGG No data
1174359602_1174359606 -2 Left 1174359602 20:50019742-50019764 CCACACATGGTGCCAGGCACACA No data
Right 1174359606 20:50019763-50019785 CAGTAGTTGCTCAGGGAAGAAGG No data
1174359598_1174359606 17 Left 1174359598 20:50019723-50019745 CCTCTCAGGCCAAACAGGGCCAC No data
Right 1174359606 20:50019763-50019785 CAGTAGTTGCTCAGGGAAGAAGG No data
1174359597_1174359606 18 Left 1174359597 20:50019722-50019744 CCCTCTCAGGCCAAACAGGGCCA No data
Right 1174359606 20:50019763-50019785 CAGTAGTTGCTCAGGGAAGAAGG No data
1174359594_1174359606 25 Left 1174359594 20:50019715-50019737 CCTATCTCCCTCTCAGGCCAAAC No data
Right 1174359606 20:50019763-50019785 CAGTAGTTGCTCAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174359606 Original CRISPR CAGTAGTTGCTCAGGGAAGA AGG Intergenic
No off target data available for this crispr