ID: 1174362343

View in Genome Browser
Species Human (GRCh38)
Location 20:50036945-50036967
Sequence GAGGGTGGGGAACTTGTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174362343_1174362353 27 Left 1174362343 20:50036945-50036967 CCTTAGACAAGTTCCCCACCCTC No data
Right 1174362353 20:50036995-50037017 GATGGAACAGTTTGGAGGCTGGG No data
1174362343_1174362352 26 Left 1174362343 20:50036945-50036967 CCTTAGACAAGTTCCCCACCCTC No data
Right 1174362352 20:50036994-50037016 TGATGGAACAGTTTGGAGGCTGG No data
1174362343_1174362351 22 Left 1174362343 20:50036945-50036967 CCTTAGACAAGTTCCCCACCCTC No data
Right 1174362351 20:50036990-50037012 TGTGTGATGGAACAGTTTGGAGG No data
1174362343_1174362350 19 Left 1174362343 20:50036945-50036967 CCTTAGACAAGTTCCCCACCCTC No data
Right 1174362350 20:50036987-50037009 ATCTGTGTGATGGAACAGTTTGG No data
1174362343_1174362349 9 Left 1174362343 20:50036945-50036967 CCTTAGACAAGTTCCCCACCCTC No data
Right 1174362349 20:50036977-50036999 CAGTTTTCTTATCTGTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174362343 Original CRISPR GAGGGTGGGGAACTTGTCTA AGG (reversed) Intergenic