ID: 1174362344

View in Genome Browser
Species Human (GRCh38)
Location 20:50036958-50036980
Sequence ACTGCAGCTCAGAGAGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174362344_1174362355 22 Left 1174362344 20:50036958-50036980 CCCCACCCTCTCTGAGCTGCAGT No data
Right 1174362355 20:50037003-50037025 AGTTTGGAGGCTGGGAATCTGGG No data
1174362344_1174362351 9 Left 1174362344 20:50036958-50036980 CCCCACCCTCTCTGAGCTGCAGT No data
Right 1174362351 20:50036990-50037012 TGTGTGATGGAACAGTTTGGAGG No data
1174362344_1174362352 13 Left 1174362344 20:50036958-50036980 CCCCACCCTCTCTGAGCTGCAGT No data
Right 1174362352 20:50036994-50037016 TGATGGAACAGTTTGGAGGCTGG No data
1174362344_1174362349 -4 Left 1174362344 20:50036958-50036980 CCCCACCCTCTCTGAGCTGCAGT No data
Right 1174362349 20:50036977-50036999 CAGTTTTCTTATCTGTGTGATGG No data
1174362344_1174362350 6 Left 1174362344 20:50036958-50036980 CCCCACCCTCTCTGAGCTGCAGT No data
Right 1174362350 20:50036987-50037009 ATCTGTGTGATGGAACAGTTTGG No data
1174362344_1174362354 21 Left 1174362344 20:50036958-50036980 CCCCACCCTCTCTGAGCTGCAGT No data
Right 1174362354 20:50037002-50037024 CAGTTTGGAGGCTGGGAATCTGG No data
1174362344_1174362353 14 Left 1174362344 20:50036958-50036980 CCCCACCCTCTCTGAGCTGCAGT No data
Right 1174362353 20:50036995-50037017 GATGGAACAGTTTGGAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174362344 Original CRISPR ACTGCAGCTCAGAGAGGGTG GGG (reversed) Intergenic