ID: 1174362348

View in Genome Browser
Species Human (GRCh38)
Location 20:50036964-50036986
Sequence AAGAAAACTGCAGCTCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174362348_1174362353 8 Left 1174362348 20:50036964-50036986 CCTCTCTGAGCTGCAGTTTTCTT No data
Right 1174362353 20:50036995-50037017 GATGGAACAGTTTGGAGGCTGGG No data
1174362348_1174362356 25 Left 1174362348 20:50036964-50036986 CCTCTCTGAGCTGCAGTTTTCTT No data
Right 1174362356 20:50037012-50037034 GCTGGGAATCTGGGTTCTCTCGG No data
1174362348_1174362350 0 Left 1174362348 20:50036964-50036986 CCTCTCTGAGCTGCAGTTTTCTT No data
Right 1174362350 20:50036987-50037009 ATCTGTGTGATGGAACAGTTTGG No data
1174362348_1174362357 26 Left 1174362348 20:50036964-50036986 CCTCTCTGAGCTGCAGTTTTCTT No data
Right 1174362357 20:50037013-50037035 CTGGGAATCTGGGTTCTCTCGGG No data
1174362348_1174362352 7 Left 1174362348 20:50036964-50036986 CCTCTCTGAGCTGCAGTTTTCTT No data
Right 1174362352 20:50036994-50037016 TGATGGAACAGTTTGGAGGCTGG No data
1174362348_1174362351 3 Left 1174362348 20:50036964-50036986 CCTCTCTGAGCTGCAGTTTTCTT No data
Right 1174362351 20:50036990-50037012 TGTGTGATGGAACAGTTTGGAGG No data
1174362348_1174362349 -10 Left 1174362348 20:50036964-50036986 CCTCTCTGAGCTGCAGTTTTCTT No data
Right 1174362349 20:50036977-50036999 CAGTTTTCTTATCTGTGTGATGG No data
1174362348_1174362354 15 Left 1174362348 20:50036964-50036986 CCTCTCTGAGCTGCAGTTTTCTT No data
Right 1174362354 20:50037002-50037024 CAGTTTGGAGGCTGGGAATCTGG No data
1174362348_1174362355 16 Left 1174362348 20:50036964-50036986 CCTCTCTGAGCTGCAGTTTTCTT No data
Right 1174362355 20:50037003-50037025 AGTTTGGAGGCTGGGAATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174362348 Original CRISPR AAGAAAACTGCAGCTCAGAG AGG (reversed) Intergenic