ID: 1174362349

View in Genome Browser
Species Human (GRCh38)
Location 20:50036977-50036999
Sequence CAGTTTTCTTATCTGTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174362347_1174362349 -9 Left 1174362347 20:50036963-50036985 CCCTCTCTGAGCTGCAGTTTTCT No data
Right 1174362349 20:50036977-50036999 CAGTTTTCTTATCTGTGTGATGG No data
1174362342_1174362349 21 Left 1174362342 20:50036933-50036955 CCAGCTGTGTGACCTTAGACAAG No data
Right 1174362349 20:50036977-50036999 CAGTTTTCTTATCTGTGTGATGG No data
1174362345_1174362349 -5 Left 1174362345 20:50036959-50036981 CCCACCCTCTCTGAGCTGCAGTT No data
Right 1174362349 20:50036977-50036999 CAGTTTTCTTATCTGTGTGATGG No data
1174362346_1174362349 -6 Left 1174362346 20:50036960-50036982 CCACCCTCTCTGAGCTGCAGTTT No data
Right 1174362349 20:50036977-50036999 CAGTTTTCTTATCTGTGTGATGG No data
1174362340_1174362349 26 Left 1174362340 20:50036928-50036950 CCCTTCCAGCTGTGTGACCTTAG No data
Right 1174362349 20:50036977-50036999 CAGTTTTCTTATCTGTGTGATGG No data
1174362339_1174362349 30 Left 1174362339 20:50036924-50036946 CCTACCCTTCCAGCTGTGTGACC No data
Right 1174362349 20:50036977-50036999 CAGTTTTCTTATCTGTGTGATGG No data
1174362344_1174362349 -4 Left 1174362344 20:50036958-50036980 CCCCACCCTCTCTGAGCTGCAGT No data
Right 1174362349 20:50036977-50036999 CAGTTTTCTTATCTGTGTGATGG No data
1174362343_1174362349 9 Left 1174362343 20:50036945-50036967 CCTTAGACAAGTTCCCCACCCTC No data
Right 1174362349 20:50036977-50036999 CAGTTTTCTTATCTGTGTGATGG No data
1174362341_1174362349 25 Left 1174362341 20:50036929-50036951 CCTTCCAGCTGTGTGACCTTAGA No data
Right 1174362349 20:50036977-50036999 CAGTTTTCTTATCTGTGTGATGG No data
1174362348_1174362349 -10 Left 1174362348 20:50036964-50036986 CCTCTCTGAGCTGCAGTTTTCTT No data
Right 1174362349 20:50036977-50036999 CAGTTTTCTTATCTGTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174362349 Original CRISPR CAGTTTTCTTATCTGTGTGA TGG Intergenic