ID: 1174362350

View in Genome Browser
Species Human (GRCh38)
Location 20:50036987-50037009
Sequence ATCTGTGTGATGGAACAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174362348_1174362350 0 Left 1174362348 20:50036964-50036986 CCTCTCTGAGCTGCAGTTTTCTT No data
Right 1174362350 20:50036987-50037009 ATCTGTGTGATGGAACAGTTTGG No data
1174362344_1174362350 6 Left 1174362344 20:50036958-50036980 CCCCACCCTCTCTGAGCTGCAGT No data
Right 1174362350 20:50036987-50037009 ATCTGTGTGATGGAACAGTTTGG No data
1174362343_1174362350 19 Left 1174362343 20:50036945-50036967 CCTTAGACAAGTTCCCCACCCTC No data
Right 1174362350 20:50036987-50037009 ATCTGTGTGATGGAACAGTTTGG No data
1174362345_1174362350 5 Left 1174362345 20:50036959-50036981 CCCACCCTCTCTGAGCTGCAGTT No data
Right 1174362350 20:50036987-50037009 ATCTGTGTGATGGAACAGTTTGG No data
1174362346_1174362350 4 Left 1174362346 20:50036960-50036982 CCACCCTCTCTGAGCTGCAGTTT No data
Right 1174362350 20:50036987-50037009 ATCTGTGTGATGGAACAGTTTGG No data
1174362347_1174362350 1 Left 1174362347 20:50036963-50036985 CCCTCTCTGAGCTGCAGTTTTCT No data
Right 1174362350 20:50036987-50037009 ATCTGTGTGATGGAACAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174362350 Original CRISPR ATCTGTGTGATGGAACAGTT TGG Intergenic