ID: 1174362351

View in Genome Browser
Species Human (GRCh38)
Location 20:50036990-50037012
Sequence TGTGTGATGGAACAGTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174362347_1174362351 4 Left 1174362347 20:50036963-50036985 CCCTCTCTGAGCTGCAGTTTTCT No data
Right 1174362351 20:50036990-50037012 TGTGTGATGGAACAGTTTGGAGG No data
1174362345_1174362351 8 Left 1174362345 20:50036959-50036981 CCCACCCTCTCTGAGCTGCAGTT No data
Right 1174362351 20:50036990-50037012 TGTGTGATGGAACAGTTTGGAGG No data
1174362344_1174362351 9 Left 1174362344 20:50036958-50036980 CCCCACCCTCTCTGAGCTGCAGT No data
Right 1174362351 20:50036990-50037012 TGTGTGATGGAACAGTTTGGAGG No data
1174362343_1174362351 22 Left 1174362343 20:50036945-50036967 CCTTAGACAAGTTCCCCACCCTC No data
Right 1174362351 20:50036990-50037012 TGTGTGATGGAACAGTTTGGAGG No data
1174362348_1174362351 3 Left 1174362348 20:50036964-50036986 CCTCTCTGAGCTGCAGTTTTCTT No data
Right 1174362351 20:50036990-50037012 TGTGTGATGGAACAGTTTGGAGG No data
1174362346_1174362351 7 Left 1174362346 20:50036960-50036982 CCACCCTCTCTGAGCTGCAGTTT No data
Right 1174362351 20:50036990-50037012 TGTGTGATGGAACAGTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174362351 Original CRISPR TGTGTGATGGAACAGTTTGG AGG Intergenic