ID: 1174363127

View in Genome Browser
Species Human (GRCh38)
Location 20:50040815-50040837
Sequence GGCATCCCAGGTTGCAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174363127 Original CRISPR GGCATCCCAGGTTGCAGGAC TGG Intergenic