ID: 1174363849

View in Genome Browser
Species Human (GRCh38)
Location 20:50044392-50044414
Sequence CCAAGGATGTGGAGACTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174363849_1174363857 27 Left 1174363849 20:50044392-50044414 CCTCAGAGTCTCCACATCCTTGG No data
Right 1174363857 20:50044442-50044464 CAATGAACAGATCCAGTTCCAGG No data
1174363849_1174363852 -8 Left 1174363849 20:50044392-50044414 CCTCAGAGTCTCCACATCCTTGG No data
Right 1174363852 20:50044407-50044429 ATCCTTGGATTTCTCCATTCTGG No data
1174363849_1174363853 -7 Left 1174363849 20:50044392-50044414 CCTCAGAGTCTCCACATCCTTGG No data
Right 1174363853 20:50044408-50044430 TCCTTGGATTTCTCCATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174363849 Original CRISPR CCAAGGATGTGGAGACTCTG AGG (reversed) Intergenic
No off target data available for this crispr