ID: 1174365625

View in Genome Browser
Species Human (GRCh38)
Location 20:50054577-50054599
Sequence CAGTATCACTTTGTCGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174365622_1174365625 2 Left 1174365622 20:50054552-50054574 CCTCGTTCCTGGCACAGAAAAGC No data
Right 1174365625 20:50054577-50054599 CAGTATCACTTTGTCGAATGTGG No data
1174365617_1174365625 24 Left 1174365617 20:50054530-50054552 CCCCATTTTTCACCATCTTTATC No data
Right 1174365625 20:50054577-50054599 CAGTATCACTTTGTCGAATGTGG No data
1174365619_1174365625 22 Left 1174365619 20:50054532-50054554 CCATTTTTCACCATCTTTATCCT No data
Right 1174365625 20:50054577-50054599 CAGTATCACTTTGTCGAATGTGG No data
1174365621_1174365625 12 Left 1174365621 20:50054542-50054564 CCATCTTTATCCTCGTTCCTGGC No data
Right 1174365625 20:50054577-50054599 CAGTATCACTTTGTCGAATGTGG No data
1174365623_1174365625 -5 Left 1174365623 20:50054559-50054581 CCTGGCACAGAAAAGCCTCAGTA No data
Right 1174365625 20:50054577-50054599 CAGTATCACTTTGTCGAATGTGG No data
1174365618_1174365625 23 Left 1174365618 20:50054531-50054553 CCCATTTTTCACCATCTTTATCC No data
Right 1174365625 20:50054577-50054599 CAGTATCACTTTGTCGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174365625 Original CRISPR CAGTATCACTTTGTCGAATG TGG Intergenic
No off target data available for this crispr