ID: 1174368032

View in Genome Browser
Species Human (GRCh38)
Location 20:50068199-50068221
Sequence TACCTGGCTGTGCCATCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174368032_1174368042 10 Left 1174368032 20:50068199-50068221 CCTTTGGATGGCACAGCCAGGTA No data
Right 1174368042 20:50068232-50068254 CAGCAGGGGTTTGTGGGAAACGG No data
1174368032_1174368037 -4 Left 1174368032 20:50068199-50068221 CCTTTGGATGGCACAGCCAGGTA No data
Right 1174368037 20:50068218-50068240 GGTAGGCATGTTCCCAGCAGGGG No data
1174368032_1174368044 19 Left 1174368032 20:50068199-50068221 CCTTTGGATGGCACAGCCAGGTA No data
Right 1174368044 20:50068241-50068263 TTTGTGGGAAACGGCTGTGGAGG No data
1174368032_1174368045 20 Left 1174368032 20:50068199-50068221 CCTTTGGATGGCACAGCCAGGTA No data
Right 1174368045 20:50068242-50068264 TTGTGGGAAACGGCTGTGGAGGG No data
1174368032_1174368035 -6 Left 1174368032 20:50068199-50068221 CCTTTGGATGGCACAGCCAGGTA No data
Right 1174368035 20:50068216-50068238 CAGGTAGGCATGTTCCCAGCAGG No data
1174368032_1174368046 26 Left 1174368032 20:50068199-50068221 CCTTTGGATGGCACAGCCAGGTA No data
Right 1174368046 20:50068248-50068270 GAAACGGCTGTGGAGGGTCCTGG No data
1174368032_1174368036 -5 Left 1174368032 20:50068199-50068221 CCTTTGGATGGCACAGCCAGGTA No data
Right 1174368036 20:50068217-50068239 AGGTAGGCATGTTCCCAGCAGGG No data
1174368032_1174368039 4 Left 1174368032 20:50068199-50068221 CCTTTGGATGGCACAGCCAGGTA No data
Right 1174368039 20:50068226-50068248 TGTTCCCAGCAGGGGTTTGTGGG No data
1174368032_1174368043 16 Left 1174368032 20:50068199-50068221 CCTTTGGATGGCACAGCCAGGTA No data
Right 1174368043 20:50068238-50068260 GGGTTTGTGGGAAACGGCTGTGG No data
1174368032_1174368038 3 Left 1174368032 20:50068199-50068221 CCTTTGGATGGCACAGCCAGGTA No data
Right 1174368038 20:50068225-50068247 ATGTTCCCAGCAGGGGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174368032 Original CRISPR TACCTGGCTGTGCCATCCAA AGG (reversed) Intergenic
No off target data available for this crispr