ID: 1174368836

View in Genome Browser
Species Human (GRCh38)
Location 20:50072829-50072851
Sequence CCTTCGGCAGGCGGGCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174368836_1174368844 -8 Left 1174368836 20:50072829-50072851 CCACCGTGCCCGCCTGCCGAAGG No data
Right 1174368844 20:50072844-50072866 GCCGAAGGGTATTTTTAAAAGGG No data
1174368836_1174368846 0 Left 1174368836 20:50072829-50072851 CCACCGTGCCCGCCTGCCGAAGG No data
Right 1174368846 20:50072852-50072874 GTATTTTTAAAAGGGAATTTCGG No data
1174368836_1174368843 -9 Left 1174368836 20:50072829-50072851 CCACCGTGCCCGCCTGCCGAAGG No data
Right 1174368843 20:50072843-50072865 TGCCGAAGGGTATTTTTAAAAGG No data
1174368836_1174368847 5 Left 1174368836 20:50072829-50072851 CCACCGTGCCCGCCTGCCGAAGG No data
Right 1174368847 20:50072857-50072879 TTTAAAAGGGAATTTCGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174368836 Original CRISPR CCTTCGGCAGGCGGGCACGG TGG (reversed) Intergenic