ID: 1174369783

View in Genome Browser
Species Human (GRCh38)
Location 20:50078758-50078780
Sequence TCCGGTCCCCAGCCCCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174369783_1174369786 -9 Left 1174369783 20:50078758-50078780 CCTGGCAGGGGCTGGGGACCGGA No data
Right 1174369786 20:50078772-50078794 GGGACCGGAGGTGTGACCCAGGG No data
1174369783_1174369788 -1 Left 1174369783 20:50078758-50078780 CCTGGCAGGGGCTGGGGACCGGA No data
Right 1174369788 20:50078780-50078802 AGGTGTGACCCAGGGAAGCCAGG No data
1174369783_1174369793 29 Left 1174369783 20:50078758-50078780 CCTGGCAGGGGCTGGGGACCGGA No data
Right 1174369793 20:50078810-50078832 CACACTCTAGGATTTGAGACAGG No data
1174369783_1174369785 -10 Left 1174369783 20:50078758-50078780 CCTGGCAGGGGCTGGGGACCGGA No data
Right 1174369785 20:50078771-50078793 GGGGACCGGAGGTGTGACCCAGG No data
1174369783_1174369792 17 Left 1174369783 20:50078758-50078780 CCTGGCAGGGGCTGGGGACCGGA No data
Right 1174369792 20:50078798-50078820 CCAGGTAAAGTGCACACTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174369783 Original CRISPR TCCGGTCCCCAGCCCCTGCC AGG (reversed) Intergenic
No off target data available for this crispr