ID: 1174369787

View in Genome Browser
Species Human (GRCh38)
Location 20:50078776-50078798
Sequence GCTTCCCTGGGTCACACCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174369787_1174369796 30 Left 1174369787 20:50078776-50078798 CCGGAGGTGTGACCCAGGGAAGC No data
Right 1174369796 20:50078829-50078851 CAGGATTTGTTTTCCTCTTGGGG No data
1174369787_1174369795 29 Left 1174369787 20:50078776-50078798 CCGGAGGTGTGACCCAGGGAAGC No data
Right 1174369795 20:50078828-50078850 ACAGGATTTGTTTTCCTCTTGGG No data
1174369787_1174369793 11 Left 1174369787 20:50078776-50078798 CCGGAGGTGTGACCCAGGGAAGC No data
Right 1174369793 20:50078810-50078832 CACACTCTAGGATTTGAGACAGG No data
1174369787_1174369792 -1 Left 1174369787 20:50078776-50078798 CCGGAGGTGTGACCCAGGGAAGC No data
Right 1174369792 20:50078798-50078820 CCAGGTAAAGTGCACACTCTAGG No data
1174369787_1174369794 28 Left 1174369787 20:50078776-50078798 CCGGAGGTGTGACCCAGGGAAGC No data
Right 1174369794 20:50078827-50078849 GACAGGATTTGTTTTCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174369787 Original CRISPR GCTTCCCTGGGTCACACCTC CGG (reversed) Intergenic
No off target data available for this crispr