ID: 1174369789

View in Genome Browser
Species Human (GRCh38)
Location 20:50078788-50078810
Sequence GCACTTTACCTGGCTTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174369789_1174369794 16 Left 1174369789 20:50078788-50078810 CCCAGGGAAGCCAGGTAAAGTGC No data
Right 1174369794 20:50078827-50078849 GACAGGATTTGTTTTCCTCTTGG No data
1174369789_1174369793 -1 Left 1174369789 20:50078788-50078810 CCCAGGGAAGCCAGGTAAAGTGC No data
Right 1174369793 20:50078810-50078832 CACACTCTAGGATTTGAGACAGG No data
1174369789_1174369796 18 Left 1174369789 20:50078788-50078810 CCCAGGGAAGCCAGGTAAAGTGC No data
Right 1174369796 20:50078829-50078851 CAGGATTTGTTTTCCTCTTGGGG No data
1174369789_1174369795 17 Left 1174369789 20:50078788-50078810 CCCAGGGAAGCCAGGTAAAGTGC No data
Right 1174369795 20:50078828-50078850 ACAGGATTTGTTTTCCTCTTGGG No data
1174369789_1174369797 19 Left 1174369789 20:50078788-50078810 CCCAGGGAAGCCAGGTAAAGTGC No data
Right 1174369797 20:50078830-50078852 AGGATTTGTTTTCCTCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174369789 Original CRISPR GCACTTTACCTGGCTTCCCT GGG (reversed) Intergenic
No off target data available for this crispr