ID: 1174369793

View in Genome Browser
Species Human (GRCh38)
Location 20:50078810-50078832
Sequence CACACTCTAGGATTTGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174369790_1174369793 -2 Left 1174369790 20:50078789-50078811 CCAGGGAAGCCAGGTAAAGTGCA No data
Right 1174369793 20:50078810-50078832 CACACTCTAGGATTTGAGACAGG No data
1174369783_1174369793 29 Left 1174369783 20:50078758-50078780 CCTGGCAGGGGCTGGGGACCGGA No data
Right 1174369793 20:50078810-50078832 CACACTCTAGGATTTGAGACAGG No data
1174369789_1174369793 -1 Left 1174369789 20:50078788-50078810 CCCAGGGAAGCCAGGTAAAGTGC No data
Right 1174369793 20:50078810-50078832 CACACTCTAGGATTTGAGACAGG No data
1174369787_1174369793 11 Left 1174369787 20:50078776-50078798 CCGGAGGTGTGACCCAGGGAAGC No data
Right 1174369793 20:50078810-50078832 CACACTCTAGGATTTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174369793 Original CRISPR CACACTCTAGGATTTGAGAC AGG Intergenic
No off target data available for this crispr