ID: 1174372419

View in Genome Browser
Species Human (GRCh38)
Location 20:50100650-50100672
Sequence CAGCTTCCATTCAGTAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174372419_1174372421 17 Left 1174372419 20:50100650-50100672 CCTTCATTACTGAATGGAAGCTG 0: 1
1: 0
2: 0
3: 13
4: 174
Right 1174372421 20:50100690-50100712 CTATTTTGAGTTGCTCTTTTTGG 0: 1
1: 0
2: 1
3: 25
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174372419 Original CRISPR CAGCTTCCATTCAGTAATGA AGG (reversed) Intronic
900752708 1:4408865-4408887 CACGTGCCATTCTGTAATGATGG - Intergenic
903529988 1:24022748-24022770 CAGATTATATGCAGTAATGAGGG - Intergenic
905295982 1:36954642-36954664 CAGCCTCCTTACAGTAATCAGGG - Intronic
905389155 1:37625209-37625231 GAGCTCCCATTCAGAAGTGATGG - Intronic
907093609 1:51753492-51753514 GAACTTCCATTGAGTACTGATGG + Intronic
910549921 1:88463917-88463939 CGGTTTCCATTCTGTAATAATGG - Intergenic
913520856 1:119644970-119644992 CTGTTTCCATTCAATTATGAAGG - Intronic
914901398 1:151713095-151713117 CAGCTTCCAGTAGGAAATGAGGG - Intronic
916002393 1:160629530-160629552 CAGTTTCCATTCAGAACTGGGGG + Intronic
919361316 1:196599084-196599106 CAGGTTCCATTAAGGAGTGATGG - Intronic
920027313 1:203008547-203008569 CAGCATCCATTCAGGAAAGGGGG - Intronic
921617085 1:217281605-217281627 CAGCTTGGCTTCAGTAAGGAAGG + Intergenic
924630703 1:245737715-245737737 CAGGTTCGAATCAGTCATGAAGG - Intergenic
1066509997 10:36084574-36084596 CTGCTTCCATTCAGTAATCTTGG + Intergenic
1067168543 10:43884989-43885011 CAGCTTCCATGCAGCTGTGAAGG + Intergenic
1068365550 10:56044873-56044895 TAGCTTCCCTTCATTAAGGAGGG - Intergenic
1071893640 10:90040742-90040764 CAGCTTCCATTTAGACATGATGG - Intergenic
1072429447 10:95357769-95357791 CAACTTCCATGCAGTGAAGAGGG - Exonic
1073668248 10:105557707-105557729 CAAACTACATTCAGTAATGAAGG + Intergenic
1076465745 10:130680548-130680570 CTGTTTCCATTGAGTGATGAGGG + Intergenic
1080181783 11:29434211-29434233 CTGCTTCCATTCATGAAAGAAGG - Intergenic
1083018312 11:59479578-59479600 AAGCTTCCATTCAGTTGTGGTGG + Intergenic
1083179170 11:60973170-60973192 CAGCTTCCCAGCAGGAATGAGGG + Intronic
1083990165 11:66241906-66241928 CAGCTGCCACTGTGTAATGAAGG + Intronic
1084627962 11:70323410-70323432 CAGCCTCCATTCTGGAATGGAGG - Intronic
1088729902 11:112671380-112671402 CAGCTACCATACAGAAAGGATGG + Intergenic
1089393538 11:118118212-118118234 CTGCTTCCATTCAGTAGTGTGGG - Exonic
1090818431 11:130318598-130318620 AAGTTTCCATTCAGTTATAATGG - Intergenic
1092223618 12:6732032-6732054 CAGCATCCATTCAGAAGTAATGG + Intergenic
1093236848 12:16619873-16619895 CAGCTGCCATGCTGTAAAGAAGG - Intergenic
1093963055 12:25296429-25296451 TAGATTCCATTTACTAATGATGG + Intergenic
1094084723 12:26576894-26576916 CAGCATCAATTCATTTATGAGGG - Intronic
1095342511 12:41108233-41108255 CAGCTGACATTCAGTAAGCAAGG - Intergenic
1099982465 12:89621452-89621474 CAGTTTACATACAGTAATGGTGG + Intronic
1101002548 12:100371229-100371251 CATCTTCCTTTCATAAATGAGGG + Intronic
1101416697 12:104514629-104514651 AAGCTTCCACTCAGGATTGAAGG + Intronic
1102720149 12:115008816-115008838 AAGCTCTCATTCTGTAATGAGGG - Intergenic
1110381176 13:74852906-74852928 GAGCTTCCATTATGTAATCAAGG + Intergenic
1111374134 13:87355434-87355456 CAGCTTCCATACACTAGCGATGG - Intergenic
1111788306 13:92819436-92819458 CAGCTTCATTTTATTAATGAGGG - Intronic
1113954833 13:114093302-114093324 AAGCTATCATTCAGAAATGAAGG - Intronic
1114371525 14:22094356-22094378 CAGCTTCCATACAGAACTGAGGG + Intergenic
1114711930 14:24787539-24787561 CAGATTCCCCTCAGGAATGAAGG + Intergenic
1122196478 14:100091222-100091244 CAGCTTCCAGTCAGAAAAGCAGG - Intronic
1123487213 15:20752160-20752182 CTTCTTCCTTTCACTAATGAAGG + Intergenic
1123543703 15:21321215-21321237 CTTCTTCCTTTCACTAATGAAGG + Intergenic
1124958732 15:34378172-34378194 CACCTGCTTTTCAGTAATGAAGG - Intergenic
1127473581 15:59311785-59311807 CAGCATCCATTTATTTATGAGGG - Intronic
1129487696 15:75891861-75891883 AAGCTTCCATTCACTATGGAGGG + Intronic
1131499763 15:92950790-92950812 AAGCTTCCTTTCAGCAATGAGGG - Intronic
1132160392 15:99536314-99536336 CAGTTTCCATTCATTAATAGGGG - Intergenic
1202952020 15_KI270727v1_random:48341-48363 CTTCTTCCTTTCACTAATGAAGG + Intergenic
1135855157 16:26003039-26003061 CAGGTTCCCATCAGTAATGTTGG + Intronic
1137341819 16:47614967-47614989 TAACTACCCTTCAGTAATGAAGG - Intronic
1139192099 16:64876707-64876729 CAGCTCCCACTTAGAAATGAGGG + Intergenic
1140570626 16:76102488-76102510 AAGCTTTCCTTCAGAAATGAAGG - Intergenic
1142909004 17:3071363-3071385 CAGCTTTGAGTCAGTAAAGAGGG - Intergenic
1142925558 17:3232879-3232901 CAGCTTTGAGTCAGTAAAGAGGG + Intergenic
1144423580 17:15120097-15120119 CAGCTTCCTTGCTGTAATAAAGG + Intergenic
1148676933 17:49451195-49451217 CAGCTTCCACCCAGCACTGATGG + Intronic
1150538173 17:66066440-66066462 CAGCTGCCATAGAGTATTGAGGG - Intronic
1150873216 17:68938740-68938762 CAGCTTCAAATCAGAATTGATGG - Intronic
1151004249 17:70415411-70415433 AAGCTACCATTGAGAAATGATGG + Intergenic
1153159173 18:2183282-2183304 CAGCTACAATTCAGAAATTACGG + Intergenic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1155529421 18:26751034-26751056 AAACTACCATTCAGTAGTGAGGG - Intergenic
1155718084 18:28971581-28971603 GAGTTTCCATTCAGTAATCTTGG - Intergenic
1158284055 18:55859250-55859272 CAGCTTGCATTCAAAAAAGAAGG - Intergenic
1160010716 18:75105598-75105620 CAGCTTCCATGCAGAACAGAGGG + Intergenic
1160409404 18:78665215-78665237 TATCTTCCATTGAGTAATGATGG - Intergenic
1160622690 18:80181708-80181730 CAGCTTCCAGCCAGGAAGGAGGG - Intronic
1160877788 19:1305239-1305261 CAGCCTCCGTTCAGTTTTGAGGG - Intergenic
1163962798 19:20712863-20712885 CAGCTTCCATACACTAGCGATGG - Intronic
1164737282 19:30551286-30551308 CATCTTCCTATCAGTAATGAAGG + Intronic
925274461 2:2638801-2638823 CAGCTTCTCTGCAGAAATGAAGG - Intergenic
925351683 2:3205425-3205447 CAGCTGCCTTGCAGTCATGAAGG + Intronic
927352090 2:22127568-22127590 AAGCTGCCCTTCAGAAATGAAGG + Intergenic
932007113 2:67938345-67938367 CAGCTGCTATTAAGTAAGGAAGG - Intergenic
932686292 2:73873272-73873294 CAGCTGCCATTCTTTATTGATGG + Intronic
932895551 2:75636275-75636297 TAGCTGCCATTGAATAATGAGGG - Intergenic
936245328 2:110821308-110821330 TAGTTTCTATTCATTAATGAAGG + Intronic
937444162 2:121942588-121942610 AAGCTAACATTCACTAATGAAGG - Intergenic
938789122 2:134661007-134661029 CAGCATCAATCCATTAATGAGGG - Intronic
940515189 2:154675584-154675606 CATCTTCCATTCTATAAGGAAGG + Intergenic
942816774 2:180061369-180061391 CAGCCTCCATACAATAGTGATGG + Intergenic
943107283 2:183561156-183561178 CAGGTATCATTCAGTAAAGAAGG - Intergenic
943982499 2:194572533-194572555 CAGCTCACCCTCAGTAATGAAGG - Intergenic
945433296 2:209791130-209791152 CAGCTGCAATTTAGTCATGAGGG - Intronic
945769535 2:214024017-214024039 TAGATTCCATTCAATAAAGATGG + Intronic
948511923 2:238473677-238473699 AAGCTGTCTTTCAGTAATGAAGG - Intergenic
948608201 2:239149552-239149574 CAACCTCCATTCAGCACTGATGG + Intronic
1168957399 20:1843981-1844003 CAGCGTCAATTCATTCATGAAGG - Intergenic
1171725443 20:28616027-28616049 CAGCTCTCATTTAGAAATGAAGG - Intergenic
1171789646 20:29510517-29510539 CAGCTCTCATTTAGAAATGAAGG - Intergenic
1173018322 20:39246683-39246705 CTGCTCCCATTCAGGAAGGAAGG - Intergenic
1174372419 20:50100650-50100672 CAGCTTCCATTCAGTAATGAAGG - Intronic
1177302457 21:19265872-19265894 CAGCTTCCACTCAGTTTTGTAGG + Intergenic
1179137508 21:38693130-38693152 CAGCTTCCATGCACTAAGGAGGG + Intergenic
1179443307 21:41411190-41411212 CAGCTTCCATGCAGCCAAGAAGG - Intergenic
1182380970 22:29887296-29887318 CTTCTTCCTTTCACTAATGAGGG - Intronic
950494860 3:13327697-13327719 CAGCTTCCTTTCTGAAATGCAGG - Intronic
952109253 3:30103818-30103840 CAGCCTCCATACACTCATGATGG - Intergenic
957835117 3:85577327-85577349 CAGCATTCATTCATTCATGAGGG - Intronic
967123018 3:186400385-186400407 CAGCTTTCATTCAGTCAGGTAGG - Intergenic
970841955 4:20483840-20483862 CAACTTCCATTCTGAAATAATGG - Intronic
971097178 4:23420381-23420403 CAGCTTCTTTTCAGGATTGAGGG + Intergenic
971903732 4:32698117-32698139 CAGCCTCCTTTCAGTAATTTGGG + Intergenic
972131274 4:35836928-35836950 CAGCTTCTATTTAATAAGGAAGG + Intergenic
973579618 4:52330059-52330081 AAGCTGTCATTCAGAAATGAAGG - Intergenic
973678356 4:53288653-53288675 AAGCTTTCCTTCAGGAATGAAGG + Intronic
975833535 4:78396470-78396492 AAGCTGTCATTCAGAAATGAAGG - Intronic
975918949 4:79359729-79359751 CATTTTCCACTCAGGAATGAGGG - Intergenic
977877192 4:102163790-102163812 CAGCATCCATGCATTCATGAGGG - Intergenic
979535368 4:121813560-121813582 CAGCTTCTATTCAGTTATCCTGG + Intronic
980202255 4:129670793-129670815 CAGATCCCCTTCAGAAATGAAGG - Intergenic
983022635 4:162698362-162698384 AAGCTATCATTCAGAAATGAAGG - Intergenic
983870634 4:172821567-172821589 CAGCTTTCAGTTACTAATGAAGG + Intronic
984938318 4:184909187-184909209 CAGCCTCCATACACTAGTGATGG - Intergenic
985774028 5:1831389-1831411 CAAGCTCCATTCATTAATGAGGG - Intergenic
986093395 5:4533195-4533217 CTTCTTACACTCAGTAATGATGG + Intergenic
987684742 5:21182611-21182633 CAGCCTCCATACACTAGTGATGG - Intergenic
988150879 5:27378049-27378071 CAGATTGCCTTCAGTAATGTGGG - Intergenic
990363641 5:55047316-55047338 CATCTTCCCAGCAGTAATGAAGG - Intergenic
992156662 5:73961962-73961984 CAGGTTCCATGCAGTAATGTTGG - Intergenic
992610710 5:78505974-78505996 CAGCACTCACTCAGTAATGAGGG - Intronic
993680199 5:90868351-90868373 CAGCAGCCTTTCATTAATGAGGG - Intronic
994959636 5:106582440-106582462 CAGTTTTAATTCAGTAATTATGG + Intergenic
996404075 5:123089747-123089769 CAGCTCCCATCCAGCAATGCTGG - Intronic
999173017 5:149611328-149611350 CAGCTGCCATGTAGAAATGAGGG + Intronic
1000091088 5:157930201-157930223 CAGCATTAATTCATTAATGAGGG + Intergenic
1002361355 5:178673807-178673829 CAGCCTCCATACACTAGTGATGG - Intergenic
1003849871 6:10210579-10210601 CAGCTTCCATTCATTTCTTATGG + Intronic
1004961898 6:20799406-20799428 CATATTCCATTCATTACTGAGGG - Intronic
1008822988 6:55656419-55656441 CAGCTCCCATGCAGTTATGTGGG + Intergenic
1010410652 6:75557710-75557732 CAGCATCCGTTCATTCATGATGG - Intergenic
1014741950 6:125156087-125156109 AAGTTTCCATCCAGTCATGAGGG - Intronic
1014813553 6:125911054-125911076 CAGCCTCCATACAATAATGATGG - Intronic
1014818748 6:125961921-125961943 CAGAATCCCTTCAGAAATGAGGG + Intronic
1015074347 6:129136926-129136948 GATCTTCCATTCAGTTATTATGG + Intronic
1016302341 6:142646378-142646400 CACCTTACATCCAGTAATGCAGG + Intergenic
1016393103 6:143594590-143594612 CAGTTTTCATTCAGTAGAGAAGG - Intronic
1017198062 6:151723481-151723503 CTTCTTCCATTTAGTAAAGAGGG - Intronic
1017338871 6:153296333-153296355 CTGGTTGCATTCAGTAATGTTGG + Intergenic
1021143487 7:17056231-17056253 CTGTTTCCATTTAGTAATCAAGG - Intergenic
1021229102 7:18064122-18064144 AATCTTCCATTCAGAACTGAGGG + Intergenic
1021963404 7:25894585-25894607 CAGCTTCCATGCAGTGATTCAGG - Intergenic
1022233794 7:28441451-28441473 CAGCTTCCCATCAGTAAAGTCGG + Intronic
1024212618 7:47218689-47218711 CAGCTTGCATTCCTTAATCAAGG - Intergenic
1024268867 7:47627249-47627271 CAGCTTCCAACCTTTAATGAGGG - Intergenic
1026420276 7:70229406-70229428 CAACTTCCAATCAGAAATAATGG - Intronic
1027952291 7:84832445-84832467 CAGCTTGAATTCTGAAATGAAGG + Intergenic
1028293217 7:89093929-89093951 AAGCTGCCAATCAGTAGTGAAGG - Intronic
1029163004 7:98566138-98566160 CAGCATTAATTCATTAATGAAGG - Intergenic
1031566729 7:123308016-123308038 GTGCTACCATTCAGTAATAATGG - Intergenic
1031615663 7:123876322-123876344 CAGCTACCATTCAGGTATGTGGG - Intronic
1034056447 7:148039914-148039936 AAGCTTCCATTTAGTAATTCAGG - Intronic
1035604920 8:924040-924062 CAGCATCCATTGCGTATTGATGG + Intergenic
1036504410 8:9342381-9342403 CAGTCTCCATTTAGTATTGAGGG - Intergenic
1038278529 8:26141909-26141931 AAGCTTCCAATCATTACTGAAGG - Intergenic
1041186356 8:55305025-55305047 CAGATTACAATCAGAAATGATGG + Intronic
1041253943 8:55962859-55962881 AAGCTTCCATTCAAAAAGGAAGG + Intronic
1045438244 8:102185844-102185866 CAGCTGCGATTCAGTCATGGGGG + Intergenic
1045623589 8:104013572-104013594 GATCTTCCAGTCATTAATGAAGG - Exonic
1045648064 8:104318455-104318477 ATCCTTCCATTCAGTGATGATGG - Intergenic
1049552809 8:143268183-143268205 CAGCCTCCATCCCCTAATGATGG - Intronic
1050406536 9:5314453-5314475 CTGCTTCCATTCAGGAATGGGGG - Intergenic
1052494494 9:29211041-29211063 CAGCTTCTATTCAGTATTCCTGG + Intergenic
1053225926 9:36357129-36357151 CAGCCTCCTTTCAGAAATGAGGG - Intronic
1055383086 9:75730448-75730470 CAGCTTCAAGTCAGTCATGGTGG + Intergenic
1056705748 9:88951626-88951648 CAGGTTCCTTTCTGTAATGTGGG + Intergenic
1056977263 9:91269768-91269790 CAGCATCCAGTCACCAATGATGG + Intronic
1057282134 9:93720615-93720637 GGGCTTCCTTCCAGTAATGAGGG - Intergenic
1059228413 9:112694737-112694759 CTGCTTCCATTCAGATATGTTGG + Intronic
1060685273 9:125605328-125605350 CAGCTTCCATTCCTTCCTGAAGG + Intronic
1203450966 Un_GL000219v1:115925-115947 CAGCTCTCATTTAGAAATGAAGG - Intergenic
1186845878 X:13530615-13530637 CATCTTCATTTCAGTGATGAAGG - Intergenic
1188108071 X:26166066-26166088 CAGCTTGAATGAAGTAATGAGGG + Intergenic
1188110158 X:26187973-26187995 AATCTCTCATTCAGTAATGATGG + Intergenic
1188746069 X:33845996-33846018 AAGCTTTCCTTCAGAAATGAAGG - Intergenic
1191752737 X:64560770-64560792 CTGCTTCCATTCATGAAGGAAGG - Intergenic
1192984826 X:76386054-76386076 TTGCTTCCATACAGTCATGAAGG - Intergenic
1194724245 X:97375848-97375870 CAGCCTCCTATCAGTAAAGATGG + Intronic
1195803859 X:108740334-108740356 CTGGTACAATTCAGTAATGATGG - Intergenic
1196011080 X:110888656-110888678 CAGCTTCCATTCAGTGATCCTGG + Intergenic
1196126544 X:112107549-112107571 AAGCTGGCATTCAGAAATGAAGG - Intergenic
1196864997 X:120063049-120063071 AAGCTACCTTTCAGAAATGAAGG + Intergenic
1196878104 X:120173283-120173305 AAGCTACCTTTCAGAAATGAAGG - Intergenic
1196898766 X:120362758-120362780 CAGCCTCCTTTAGGTAATGAGGG - Intronic