ID: 1174372504

View in Genome Browser
Species Human (GRCh38)
Location 20:50101964-50101986
Sequence TACTACTGGACTTTACCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174372499_1174372504 21 Left 1174372499 20:50101920-50101942 CCTTCTCTGAAATCTGACAAAAG No data
Right 1174372504 20:50101964-50101986 TACTACTGGACTTTACCTTAAGG 0: 1
1: 0
2: 0
3: 5
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174372504 Original CRISPR TACTACTGGACTTTACCTTA AGG Intronic
910135521 1:83964092-83964114 TACTAATAGACTTTACGTGAAGG + Intronic
915140252 1:153763505-153763527 TTCTTCTGCACTTTACGTTAGGG + Intronic
915794250 1:158710129-158710151 TTCTCCTGGACTTTTCCTTATGG + Intergenic
916463246 1:165048056-165048078 TCCTACTGCACTTTACCGGAAGG + Intergenic
917278877 1:173360270-173360292 TTCTCCTGGACTGTGCCTTATGG + Intergenic
918564651 1:185914460-185914482 TATTACTTAACTTTACCTTGAGG + Intronic
1067009207 10:42693770-42693792 TAGTAGTGGACTCTCCCTTAGGG + Intergenic
1067011433 10:42717552-42717574 TCCTACTGGACCTTATCTTTAGG - Intergenic
1067312148 10:45124276-45124298 TCCTACTGGACCTTATCTTTAGG + Intergenic
1068196311 10:53721621-53721643 TACTTCTGGTCTTTCTCTTATGG + Intergenic
1068512796 10:57987324-57987346 TGCTACTTGGCATTACCTTATGG - Intergenic
1071252702 10:83837238-83837260 TATTACTTGACAATACCTTATGG - Intergenic
1072459167 10:95603813-95603835 TACTTCTGGACTTCTCATTATGG + Intergenic
1074943099 10:118254128-118254150 TACTAGTGGTCTTTGCCTTTTGG - Intergenic
1079861787 11:25681609-25681631 TACTAGCTGACTTTACCTAAAGG - Intergenic
1082664196 11:55953345-55953367 TACTATTTTACTTTACTTTAGGG - Intergenic
1095812544 12:46385423-46385445 TACTACTGGTTTTTTCCTTCTGG + Intergenic
1101385263 12:104251748-104251770 AACAACTGGATTTTACCTTTAGG + Intronic
1105846711 13:24299884-24299906 TGCTACTGGACTTTACAGTGAGG + Intronic
1106166660 13:27252876-27252898 GACTGCTGTATTTTACCTTATGG + Intronic
1108708223 13:53009094-53009116 TCCTACTGTGCTTTTCCTTATGG - Intergenic
1109396252 13:61763963-61763985 TACTTCTTGAATTTACATTAAGG + Intergenic
1110360435 13:74618827-74618849 TACTAATGGCCTATACTTTATGG - Intergenic
1115196162 14:30802061-30802083 TACTACTGGACTTTCATTGATGG + Intergenic
1115287852 14:31736726-31736748 GACTGCTGGATTTTAGCTTAGGG + Intronic
1116626797 14:47275524-47275546 TTAAACTGGACTTTGCCTTAGGG - Intronic
1118843959 14:69532544-69532566 GACTGCTGGACTTTATCTGAGGG - Intergenic
1120637267 14:86967648-86967670 TACTACTGTATTTCACATTAGGG - Intergenic
1141606416 16:85156444-85156466 TTCTTCTGGACTTGAACTTAGGG + Intergenic
1156757343 18:40544171-40544193 CCCAACTGGACTTTACCATACGG - Intergenic
1162571526 19:11476973-11476995 TATTACTGGTCTTTTCGTTAGGG - Intronic
1163198141 19:15740218-15740240 TACTACTGCACTGTAACCTAGGG + Intergenic
1168128714 19:54302712-54302734 TACTAGAGGTATTTACCTTAAGG - Intergenic
932131965 2:69195787-69195809 TACTACTGAACCTTAGTTTAGGG - Intronic
932869565 2:75384363-75384385 TACTACTGAATTTTAACTTTAGG + Intergenic
940913811 2:159232617-159232639 AACTACTGTACTTTTCCATATGG + Exonic
941072141 2:160967397-160967419 TTCTACTGACCTTCACCTTAAGG + Intergenic
943220738 2:185102352-185102374 TACTACTTGATATTACCATATGG + Intergenic
944670692 2:201992109-201992131 TCCTGCTGGACTTAACCTCAAGG - Intergenic
945364335 2:208932555-208932577 TACTACTTTACTTTACATTAAGG - Intergenic
947886476 2:233576183-233576205 TACTAGTGGACTTAACATTCTGG + Intergenic
1174372504 20:50101964-50101986 TACTACTGGACTTTACCTTAAGG + Intronic
1177864541 21:26497570-26497592 TGCTACTGGAACTTCCCTTAGGG - Intronic
1180916156 22:19488893-19488915 TACTACAGGATTTTACCATTGGG - Intronic
1184914233 22:47558148-47558170 TACTACTTTGCTTTATCTTATGG + Intergenic
956281536 3:67562141-67562163 CTCTACTGGACTCTACCCTAAGG - Intronic
958639633 3:96788925-96788947 CACTACTGGAATTTACCCAAAGG - Intergenic
959750149 3:109824713-109824735 CTTTACTGGACTTTAACTTAAGG + Intergenic
963671388 3:148256398-148256420 CCCTGCTGGACTTTGCCTTATGG - Intergenic
966847670 3:184143244-184143266 TACTACTGGTCTTTCCATTTGGG - Intronic
972834439 4:42852802-42852824 TACTACACTACTTTACCTTTTGG - Intergenic
974962122 4:68715905-68715927 AACTACTAGACCTTACCTAAAGG + Intergenic
975172535 4:71248603-71248625 TACTTCAGGAATCTACCTTAAGG - Intronic
975262485 4:72320020-72320042 TACAACTGGACTTTTGCCTAGGG + Intronic
978935767 4:114373273-114373295 TACTTTTGGACTTTATTTTATGG + Intergenic
979737898 4:124111180-124111202 TACCTCTAGAATTTACCTTAGGG - Intergenic
981224273 4:142274168-142274190 TTCTACTGAATTTTACCTTATGG + Intronic
982338112 4:154262420-154262442 TACTACTGGACTCTGTCTAATGG + Intronic
991265766 5:64715384-64715406 GACTAATGGACTTCCCCTTAGGG + Intronic
997391221 5:133518626-133518648 TACTACTAGACTCTATGTTAAGG + Intronic
997504732 5:134408193-134408215 GGCTACTGGAGTATACCTTATGG - Intronic
1002859015 6:1063478-1063500 TACTGCTGGACTTTTGCTCAAGG + Intergenic
1005214948 6:23514758-23514780 TTCTAATGGATGTTACCTTATGG - Intergenic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1011990676 6:93512120-93512142 TACAACTGGATATTATCTTAAGG + Intergenic
1020345760 7:7161857-7161879 TTCTATTGAAGTTTACCTTAAGG + Intronic
1021514483 7:21468768-21468790 TAATACTGTACATTTCCTTAAGG - Intronic
1021922652 7:25502074-25502096 TACCACTGGACTGTACCTCATGG + Intergenic
1024085386 7:45888254-45888276 TAGAACTGGACTTTAACTGAGGG + Intergenic
1024941128 7:54764514-54764536 TACTAATAGACTTTATTTTAAGG - Intergenic
1030447577 7:109666796-109666818 TACTAATTGGCTTTACCTAAAGG - Intergenic
1030870285 7:114747312-114747334 TGCTACTGAACTTTGCCTTGGGG - Intergenic
1034258996 7:149742441-149742463 TACTCCCGAACATTACCTTAAGG + Intergenic
1038439780 8:27563558-27563580 TACTACTGGGTATTACCTAAGGG - Intergenic
1043247442 8:78022719-78022741 TTCCCCTGGACTTTCCCTTATGG - Intergenic
1046017589 8:108623842-108623864 TATTACTGGCCTTTACCTACAGG - Intronic
1047997960 8:130354840-130354862 TACTTCTGGGCTTTACCTTTTGG - Intronic
1048893144 8:138965616-138965638 TACCACTGGACTTCACCCTCTGG + Intergenic
1055035105 9:71810208-71810230 TACTACTCTACTTTATATTAGGG + Intronic
1188142920 X:26574221-26574243 TACTAATTGCCTTTATCTTATGG - Intergenic
1190801904 X:53796879-53796901 TACTATTGGGCTTTCCTTTAAGG - Intergenic
1192760076 X:74087495-74087517 AACTAAAGGACTTTATCTTAAGG + Intergenic
1194975207 X:100388586-100388608 TACTTCTGGAATTTATCCTAAGG - Intronic
1195860284 X:109375882-109375904 TCCTCCTGGCCATTACCTTATGG + Exonic
1196025851 X:111040878-111040900 TACCACTGGATTATACCCTAGGG - Intronic