ID: 1174373099

View in Genome Browser
Species Human (GRCh38)
Location 20:50107106-50107128
Sequence ACAGCCAGACTACACTTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174373099_1174373102 -5 Left 1174373099 20:50107106-50107128 CCGCCCAAGTGTAGTCTGGCTGT 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1174373102 20:50107124-50107146 GCTGTCTAGTTAGCCTGCCCAGG 0: 1
1: 0
2: 1
3: 5
4: 105
1174373099_1174373106 27 Left 1174373099 20:50107106-50107128 CCGCCCAAGTGTAGTCTGGCTGT 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1174373106 20:50107156-50107178 CTTCTCCTTCTCTAGAGCAATGG 0: 1
1: 0
2: 1
3: 28
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174373099 Original CRISPR ACAGCCAGACTACACTTGGG CGG (reversed) Intronic
900754156 1:4422056-4422078 CCAGCCCAACTACACTTGTGAGG + Intergenic
906007469 1:42488565-42488587 ACACCTATACAACACTTGGGAGG - Intronic
910928282 1:92418316-92418338 CCAGCCAGAGTACACATGTGGGG - Intergenic
914824547 1:151132030-151132052 ACTGCCTGACTTCACTCGGGCGG - Exonic
918646463 1:186911703-186911725 AGAACCTGACTAAACTTGGGAGG - Intronic
921370283 1:214415808-214415830 ACAGCCATACCACTCTTTGGTGG + Intronic
921785744 1:219227947-219227969 ACAGCCTGGCTACACTGTGGAGG - Intergenic
1070595279 10:77828821-77828843 ATAGGCAGATTACATTTGGGAGG - Intronic
1071107995 10:82121169-82121191 GCAGCCAGACTAAACTGTGGTGG - Intronic
1073131199 10:101190228-101190250 ACACCCAGACTGCATTAGGGTGG + Intergenic
1078918654 11:15805940-15805962 ACAACCAAAATAAACTTGGGTGG - Intergenic
1080202254 11:29686023-29686045 ACATACAGAATACACTTGGAAGG - Intergenic
1091299616 11:134498976-134498998 ACAGCCACGCTGCACATGGGAGG - Intergenic
1091422828 12:357928-357950 ACAGCCATACTACAACTGGGAGG + Intronic
1097394674 12:59059351-59059373 AGAGCCAAACTACACTGGGAAGG - Intergenic
1104727116 12:131084916-131084938 ACGCCCAGACTGCACCTGGGGGG + Intronic
1107814808 13:44234862-44234884 ACAACAAAACTACACTTGGATGG - Intergenic
1110910447 13:80955336-80955358 ACAGCCAGATTGCACATGGTTGG - Intergenic
1115403641 14:32992032-32992054 AGAGCCAGATTACACTTAGAAGG + Intronic
1118464086 14:66015009-66015031 ACATCCATATTACACTTGGAAGG - Intergenic
1125613124 15:40986115-40986137 AAAGCCAGAAAACACATGGGAGG + Intronic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1130684965 15:86029151-86029173 TCAGCCAGACTAAACGTGGAAGG + Intergenic
1130912809 15:88282627-88282649 ACAGGCAGACGCCACTGGGGAGG - Intergenic
1131503333 15:92992285-92992307 ACAGACAGTCTACCCCTGGGTGG - Intronic
1132966944 16:2661733-2661755 CCAGCCAGGTTACACTTTGGCGG + Intergenic
1133804418 16:9113784-9113806 ACCGCAAGACTAAACTTGAGGGG - Intronic
1134399160 16:13893019-13893041 ACAGCCAGATTACATTGGAGGGG + Intergenic
1134866070 16:17608266-17608288 ACAGCAAGACTATGCTTGAGGGG + Intergenic
1138507192 16:57484278-57484300 ACAGCCAGACGACACTGAGATGG - Intronic
1144071169 17:11672398-11672420 AAAGTCAGCCTCCACTTGGGAGG - Intronic
1146657533 17:34643824-34643846 ACTGCCAGACTCCACTGAGGAGG - Intergenic
1147836946 17:43339856-43339878 CCAGCCATATTACACTTTGGTGG + Intergenic
1167114910 19:47483521-47483543 ACAACCAGACCCCGCTTGGGGGG + Exonic
926390089 2:12380869-12380891 ACAGCCACACTAAACTTCAGTGG + Intergenic
927120004 2:19949936-19949958 TCAGGCAGATTAAACTTGGGGGG + Intronic
927596338 2:24401252-24401274 AAAGCCAGACCTCACTTTGGAGG + Intergenic
928710278 2:33997430-33997452 GGAGCCAGGATACACTTGGGTGG + Intergenic
937205881 2:120236928-120236950 ACACCCCCACTGCACTTGGGAGG - Intergenic
1168911370 20:1449888-1449910 ACAGCAAGAGTGCACTTGGGAGG - Intronic
1174373099 20:50107106-50107128 ACAGCCAGACTACACTTGGGCGG - Intronic
1175549454 20:59807899-59807921 ACAGCCAGACGGCAGATGGGTGG - Intronic
1182860105 22:33552381-33552403 ACAGTCAGTCTCCACATGGGAGG + Intronic
1183926646 22:41211123-41211145 ACAGGCAGCCCACACATGGGAGG - Intronic
1184330072 22:43821684-43821706 ACAGCCACACAACACTGAGGTGG + Intergenic
950918946 3:16673588-16673610 ACAGCCAAACTAACTTTGGGAGG - Intergenic
954720875 3:52561833-52561855 ACACCCAGACTACTCTTTCGGGG - Exonic
955727505 3:61948684-61948706 AAAGTCAGACTCCACTTTGGAGG - Intronic
957898722 3:86459267-86459289 ATAGTCAGACTTCATTTGGGGGG + Intergenic
958005058 3:87799982-87800004 ACAGTCAGACTACTCTTAGATGG + Intergenic
961187212 3:124926227-124926249 ACAGCCAGAAGAGATTTGGGGGG + Intronic
963318172 3:143783456-143783478 ACTGCGAGACCACACTTAGGGGG - Intronic
965492908 3:169361790-169361812 ACAGCCATGCTACATTTGAGAGG + Intronic
965643863 3:170859609-170859631 CCAGCCAGGTTACACTTTGGCGG - Intronic
969297181 4:6277085-6277107 GCAGCCAGGCTCCACATGGGTGG + Intronic
971515893 4:27485982-27486004 ACAGCTAGACTACACGTGCATGG + Intergenic
971549255 4:27928504-27928526 ACAGCCAGAAAACACATGGCTGG - Intergenic
971765385 4:30824263-30824285 ACACACAGGCTACACTTGGTGGG - Intronic
972008095 4:34137637-34137659 ACAGCCACACTATAATAGGGGGG - Intergenic
979604431 4:122622872-122622894 TCAGCCAGAATACACTTGTGTGG + Intergenic
984230559 4:177093195-177093217 ACAGCCAGAGTAACCTTGGCAGG - Intergenic
985826086 5:2192557-2192579 CCTGCTAGACTTCACTTGGGTGG + Intergenic
986337367 5:6765758-6765780 TCAGCCAGACTCCACGTGGAGGG - Intergenic
987362352 5:17119021-17119043 GCAGACAGACCAGACTTGGGAGG + Intronic
995239208 5:109866595-109866617 ACATACAGACTACGCTTGGAAGG - Intronic
996413530 5:123184628-123184650 AGAGCCAGACTTCACTTGGTTGG - Intronic
998881321 5:146648087-146648109 ACAGCCAGACTACATTTCCTAGG + Intronic
1001412206 5:171519773-171519795 AAAGCCAGCCTTCTCTTGGGAGG + Intergenic
1008660303 6:53660971-53660993 ACAGACTGAGAACACTTGGGTGG - Intronic
1010091465 6:71987624-71987646 ACAATAAGACTACACTTGGCTGG + Intronic
1015792155 6:136974361-136974383 ACACCCAGACTCCACGAGGGAGG + Intergenic
1015915333 6:138210440-138210462 ACAGAAAGACCACAGTTGGGAGG + Intronic
1024098210 7:46003349-46003371 AGAGTCAGATTACACTTGGCTGG + Intergenic
1029345835 7:99978053-99978075 CCAGCCAGATTACACTTTGGCGG - Intergenic
1034821968 7:154224046-154224068 ACAGCCTGACTATCCCTGGGAGG + Intronic
1038248868 8:25884212-25884234 ACAGCAAGATTACAAGTGGGAGG - Intronic
1039553547 8:38460518-38460540 GCAGCCAGCCCACACCTGGGAGG - Intronic
1047985155 8:130225611-130225633 ACACACAGACAACACTTGGATGG + Intronic
1050518479 9:6471418-6471440 TCAGCCATACTTCACTAGGGTGG + Intronic
1054157204 9:61649311-61649333 ACAGCCAGCTTACATTTGGAGGG - Intergenic
1054476979 9:65580316-65580338 ACAGCCAGCTTACATTTGGAGGG - Intergenic
1055038182 9:71840433-71840455 ACTGCCAGACTTCAATTTGGTGG - Intergenic
1059507513 9:114813277-114813299 ACAGCCAGAATCCACTCTGGTGG - Intergenic
1188323197 X:28765992-28766014 ACAGACATGCTACACTTTGGTGG - Intronic
1189566030 X:42242139-42242161 GCAGCCAGCCTTCACTTGGAGGG - Intergenic
1190652370 X:52579653-52579675 ACAGCCAGTCTACCTGTGGGAGG - Intergenic
1192808551 X:74530572-74530594 ACAGCCACACTACCCATTGGGGG + Intronic
1192845173 X:74899766-74899788 ATAGCCAGAGTAATCTTGGGGGG + Intronic
1196090447 X:111735783-111735805 GCAGCCACACTGCAGTTGGGTGG + Intronic
1200151890 X:153955249-153955271 ACAGACGAACTGCACTTGGGTGG + Exonic