ID: 1174373424

View in Genome Browser
Species Human (GRCh38)
Location 20:50109795-50109817
Sequence TTCCCCTCCATCACTGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174373421_1174373424 -9 Left 1174373421 20:50109781-50109803 CCAACAAAGCCAGTTTCCCCTCC 0: 1
1: 0
2: 10
3: 155
4: 898
Right 1174373424 20:50109795-50109817 TTCCCCTCCATCACTGGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 190
1174373420_1174373424 -8 Left 1174373420 20:50109780-50109802 CCCAACAAAGCCAGTTTCCCCTC 0: 1
1: 0
2: 3
3: 26
4: 275
Right 1174373424 20:50109795-50109817 TTCCCCTCCATCACTGGAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174373424 Original CRISPR TTCCCCTCCATCACTGGAGC AGG Intronic
900426885 1:2585020-2585042 CTGCTCTGCATCACTGGAGCTGG + Intergenic
900461648 1:2804782-2804804 TTCCCCTCTCTAACTGGGGCTGG - Intergenic
904318230 1:29679910-29679932 TTCCACTTCAGGACTGGAGCAGG + Intergenic
905493245 1:38361810-38361832 TTCCCACCCTTCACTGGGGCTGG - Intergenic
905655801 1:39685190-39685212 TTCATCTCCATCACTGGCACAGG - Intronic
907336323 1:53702161-53702183 CTCCCCACCATCACAGCAGCAGG + Intronic
910752383 1:90646919-90646941 TTTTCCTCCATCAATGAAGCAGG - Intergenic
911176254 1:94820642-94820664 CTCCGCCCCAGCACTGGAGCAGG - Intronic
911405279 1:97430167-97430189 CTCCCAGCCATCACTGGAACAGG - Intronic
911690847 1:100832585-100832607 TCCCCCTCCACCAGTGGATCTGG + Intergenic
912307341 1:108582704-108582726 TTGCCCTCCAGCTCTGTAGCAGG + Intronic
912997969 1:114550646-114550668 TTCCCCTCTAGCACTGGAAATGG + Intergenic
913098896 1:115545243-115545265 TTCCCCTCCAACACTGTCCCAGG - Intergenic
914982387 1:152426136-152426158 TTGCCCTACATCAATGGAACTGG + Intergenic
914998471 1:152565517-152565539 TTCCCTTCCATCAGTGGAGCGGG + Intronic
915518343 1:156426866-156426888 TTCTCCTCCTTGACAGGAGCTGG - Exonic
915622227 1:157092773-157092795 TTTGCCTCCATCATGGGAGCAGG + Exonic
915812996 1:158935810-158935832 TTCCCATCCTTTACTGGGGCTGG - Intronic
920842987 1:209570507-209570529 TCTCCCTCCAGCACTTGAGCCGG + Intergenic
921555700 1:216596357-216596379 GCCCCCTCCATCTCTGAAGCTGG - Intronic
924325839 1:242893136-242893158 TTCTCCTCCATGGCAGGAGCAGG - Intergenic
924538696 1:244960910-244960932 TCCCCCTCCAAGACTGGAGAGGG + Intergenic
924912088 1:248524371-248524393 CTCCTCTCCATTACTGGAGGAGG - Intergenic
1062797831 10:357907-357929 TTCCCCACCATCACAGAGGCAGG + Exonic
1063956205 10:11269988-11270010 CTACCCGCCATCCCTGGAGCTGG - Intronic
1066692128 10:38040263-38040285 TTCCACTCGAACAGTGGAGCAGG - Intronic
1068287579 10:54961120-54961142 TGCTCCTCCAACACTGCAGCTGG - Intronic
1070330426 10:75412736-75412758 TTCCCTTGCATCCCTGTAGCTGG + Intergenic
1070742552 10:78912458-78912480 TTCTCCTCCACCGCTGCAGCTGG + Intergenic
1074033767 10:109717102-109717124 TTCCCTTCCTTAACTGGCGCAGG + Intergenic
1075327360 10:121544653-121544675 TTCCCCTCCCCCACTGCACCTGG - Intronic
1076296774 10:129391777-129391799 TTCCCCTAGAACACTGGATCTGG + Intergenic
1076499589 10:130926919-130926941 CTCACCTCCAGCACTGGTGCAGG - Intergenic
1076628621 10:131839153-131839175 TTCCCCTTCATCACTGTGGCAGG - Intergenic
1077389694 11:2294526-2294548 ATCCCCTGCAACACTGGGGCAGG + Intergenic
1078722339 11:13896692-13896714 CTGCCCTCCAGCACTAGAGCAGG - Intergenic
1080884059 11:36349434-36349456 TTCCCCTCCCTCACTGGCCCTGG - Intronic
1081435323 11:43021499-43021521 TTCATCTCCAACAGTGGAGCTGG - Intergenic
1083227323 11:61293534-61293556 GTCCAGTCCATGACTGGAGCTGG - Intronic
1084454832 11:69262460-69262482 TTCCCCTCCATGCCTGAAGATGG + Intergenic
1087350469 11:97025469-97025491 GTCCCCTCAATAAGTGGAGCTGG + Intergenic
1091084993 11:132712912-132712934 TCGCTCTTCATCACTGGAGCAGG + Intronic
1091089227 11:132754065-132754087 TTCCCTTCCCTTAGTGGAGCTGG - Intronic
1091534255 12:1390862-1390884 TTCCTCTCCATTCCTGGAGTGGG - Intronic
1092291483 12:7161966-7161988 TTTCCCTGCGTCACTGGAGCTGG - Intergenic
1094060376 12:26308795-26308817 TTCCCCTCCAACACTGTATAAGG - Intergenic
1096331690 12:50718717-50718739 TTCCCAACCATCACGGAAGCAGG - Exonic
1098514498 12:71358421-71358443 TTACCCTGCTTCCCTGGAGCTGG + Intronic
1100031840 12:90202218-90202240 TCCCACTCCATCACTGGGGCTGG + Intergenic
1101584323 12:106071278-106071300 TTTACCTCCGTCACTGGGGCAGG - Intronic
1102376508 12:112426059-112426081 TTTCCCCACATCACTGGAGGAGG + Intronic
1102558767 12:113747366-113747388 TTCCCCTCTAGCACAGGAGAAGG - Intergenic
1102849177 12:116223107-116223129 TTCCAGTCCAACACTGGAGTTGG - Intronic
1103767766 12:123293902-123293924 TGCACCTCCACCACTGGAGTGGG + Exonic
1104684066 12:130772837-130772859 TGCCTCTCCATGACTGGAGGTGG - Intergenic
1105492402 13:20902115-20902137 TTCCCCTCCCTCCCTCCAGCCGG + Intronic
1106475750 13:30096670-30096692 ATGCCCTCCATCAATGGGGCAGG - Intergenic
1108225648 13:48286323-48286345 TTCCTCTTCCCCACTGGAGCAGG - Intergenic
1109762340 13:66845684-66845706 TGCACCTCCCTCACTGCAGCTGG + Intronic
1110886868 13:80650307-80650329 TTCTCCTCCATCAGGGTAGCTGG + Intergenic
1113130227 13:107028377-107028399 TTCCCCTCCATCATGTGAGTGGG - Intergenic
1113432786 13:110264966-110264988 TTCCCCTCCTTCCCTGTTGCTGG + Intronic
1119481365 14:74960344-74960366 TTCCCCTCCATCATGGCACCTGG + Intergenic
1119913085 14:78368984-78369006 TTCCCATTCATCTGTGGAGCTGG - Intronic
1121473791 14:94175328-94175350 ATCCCCTCCAGGACTGTAGCTGG + Intronic
1121790634 14:96697075-96697097 TACCAGTCCATCACTGGAGAAGG - Intergenic
1122519357 14:102332522-102332544 GTCCCCTCCATCCCTAGAACAGG - Intronic
1122777983 14:104131247-104131269 CTCCCCTCCAACACGGGATCTGG - Intergenic
1126696394 15:51329515-51329537 TTTCCCTCCATCAGTGGCCCTGG - Intronic
1127207074 15:56732748-56732770 ATTCCTTCCATCGCTGGAGCAGG + Intronic
1129616208 15:77100348-77100370 TTTTCGTCCATCCCTGGAGCAGG - Intergenic
1130019201 15:80213128-80213150 TTCCTCTCCATCTGTGGACCTGG - Intergenic
1131097872 15:89667242-89667264 TTCCCCTCTAGCCCTGGGGCTGG - Intronic
1131824363 15:96306178-96306200 TTCCCCTCCATCTCTCTAGTTGG + Intergenic
1135981351 16:27149964-27149986 TCTCACTCCATCACTGAAGCTGG - Intergenic
1136374318 16:29856343-29856365 TTCCCCACCTTGACTGGAGCAGG + Intergenic
1137843660 16:51665581-51665603 TCCCCCGGCCTCACTGGAGCGGG + Intergenic
1138514061 16:57526256-57526278 TGCCTCTCCATCTCTGGAGAAGG + Intronic
1138611592 16:58129367-58129389 TTCCCCGCCTTCAATGGAGGCGG + Exonic
1142372597 16:89691393-89691415 TTCCCCGCCATCACTGGGGTGGG + Intronic
1142987264 17:3703691-3703713 TTCCCCTCCAGCTCTGGTGAGGG + Intergenic
1143670715 17:8393841-8393863 TTCACTTCCGTCACTGAAGCAGG - Intronic
1146039223 17:29434939-29434961 TTCCTCTCCCTTACTGGAGGAGG - Intronic
1147511457 17:41072410-41072432 TTCCCCTTCTCCACTGGACCTGG + Intergenic
1147909149 17:43844459-43844481 TGCCCCACCATCACTGCACCTGG - Intergenic
1147911014 17:43856296-43856318 TTGCCATCCAGCACGGGAGCCGG - Intronic
1148053844 17:44781956-44781978 TTCCTCACCATGAATGGAGCTGG - Intergenic
1148127129 17:45242657-45242679 TTCCCCTCCATCCCTGCAGAGGG + Intronic
1148557582 17:48587669-48587691 TTCCTCTCCATAACTGTGGCAGG - Intronic
1156993635 18:43440020-43440042 TTCCCCTCTATCAGGGGAACCGG - Intergenic
1157217074 18:45793164-45793186 TTGGCCTCCATCTCTGTAGCAGG + Intergenic
1158291533 18:55950386-55950408 TTCTCCTCCTTTACTTGAGCCGG - Intergenic
1162840674 19:13354329-13354351 TTGTCCTCCATGACTGGTGCTGG - Intronic
1163824289 19:19514397-19514419 TTCCCCGCGATCCCGGGAGCTGG - Exonic
1164780241 19:30885953-30885975 TTCCACTCCATAACTGGGTCGGG - Intergenic
1165608957 19:37133915-37133937 TTTTCCTCCACCACCGGAGCAGG - Intronic
1167299346 19:48670257-48670279 TTCCCTTCCCTCGCTGGAACTGG - Intronic
1167413355 19:49357682-49357704 CTCACCTCCAACACTGGAGATGG - Intronic
1167436440 19:49481249-49481271 GTCCACCCCATCACTGGACCAGG - Intronic
1167534568 19:50041535-50041557 TCCCTCTCCATCACTGGACTGGG + Intronic
1167709644 19:51102552-51102574 CTCACCTCCATCACCGCAGCTGG + Intronic
925608804 2:5685885-5685907 TTGCTCTCCAGCACTGGTGCAGG + Intergenic
926158048 2:10468927-10468949 TTCACCCCCATCACTGGAGAGGG + Intergenic
926206283 2:10836137-10836159 TTCCCCTTCATCACTGGTGGTGG - Intronic
928399595 2:30968350-30968372 AGCCCCTCCCTCACTGAAGCAGG + Intronic
929268910 2:39950973-39950995 TCCCCCTCCCTCCCTGGAGATGG - Intergenic
929562684 2:42965559-42965581 TCCCCCTCCTTGACTGGGGCAGG - Intergenic
929686555 2:44040052-44040074 CTCCCCTCCATCACTGGTTCAGG - Intergenic
931316546 2:61138376-61138398 TTCCCCTACTTCATTGAAGCAGG - Intergenic
934954816 2:98608618-98608640 TTCCCTTCCCTCAACGGAGCCGG - Exonic
936608043 2:113977063-113977085 TTCCCCTTGATTACTGAAGCAGG - Intergenic
938973756 2:136456320-136456342 TTCCCCTTCCTCACTGCACCTGG + Intergenic
946113638 2:217442811-217442833 TTGCCCTCCATAACATGAGCAGG - Intronic
948600005 2:239102320-239102342 TTCCCCTCCACCACCTGTGCAGG + Intronic
1169026990 20:2379947-2379969 TTCCCCTTCCTCACTGGCCCAGG + Intergenic
1169178250 20:3538713-3538735 TTCACCTCCATCTCTACAGCTGG + Intronic
1169473217 20:5906845-5906867 TTGCCCTCCATTTCTGGAACAGG + Intergenic
1172078218 20:32316051-32316073 TGCCCATCCATCACTGGTGAGGG - Intronic
1173664691 20:44755667-44755689 TGCCCCTTCATCTCTGGGGCAGG + Intronic
1174373424 20:50109795-50109817 TTCCCCTCCATCACTGGAGCAGG + Intronic
1175205640 20:57309191-57309213 TCCCCCTGGAGCACTGGAGCTGG - Intergenic
1175220861 20:57415541-57415563 AACGCCCCCATCACTGGAGCAGG - Intergenic
1175227030 20:57450684-57450706 CTGCCCCCCCTCACTGGAGCAGG - Intergenic
1176126669 20:63478607-63478629 CTCCCCACCTTCTCTGGAGCTGG + Intergenic
1178776465 21:35556024-35556046 TTCCCCTCCATCAGAGCATCTGG + Intronic
1179042083 21:37812244-37812266 CTCCCCTGAATCACTGCAGCTGG - Intronic
1179883724 21:44304559-44304581 TCCCCCACCCTCACTGGAGTTGG - Intronic
949322032 3:2822061-2822083 TTCCCCTCTATGTCTGGATCAGG + Intronic
952126740 3:30309613-30309635 TTGCCATCCATCACTAGGGCTGG + Intergenic
952970754 3:38649191-38649213 TTCCCGGCCATCCCTGGCGCAGG - Intronic
955019470 3:55105343-55105365 CTCCCCTCCAGCATGGGAGCTGG + Intergenic
958052451 3:88365693-88365715 TTCCTCTCTATCACTGGTGAAGG - Intergenic
960496445 3:118381601-118381623 TCCAAATCCATCACTGGAGCTGG + Intergenic
961072181 3:123943292-123943314 TTCACCTTTATCACTGAAGCTGG - Intronic
961529916 3:127534131-127534153 TTCACCTTCATCACTGGTGGAGG - Intergenic
961772202 3:129258233-129258255 TCCAGCTCCAGCACTGGAGCAGG + Intronic
961979464 3:131061809-131061831 CTCCCTGCCATCACTGGTGCTGG + Intronic
962204154 3:133421401-133421423 TTGCCCGCCATCACCAGAGCTGG - Intronic
962944296 3:140153442-140153464 TTCCCCTCCAGTTCTGGGGCAGG + Intronic
962957377 3:140278592-140278614 TTCCCCTCCAGGACTGGCCCAGG - Intronic
966002074 3:174961934-174961956 CTCCCCTGCAACACTGTAGCAGG + Intronic
968234922 3:197025912-197025934 AGCCCCTCCCTCTCTGGAGCAGG - Intronic
968712780 4:2131704-2131726 TTCCCCTCCCTCACTGCTCCTGG + Intronic
969716268 4:8869771-8869793 TCCCACTTCCTCACTGGAGCTGG - Intronic
969806241 4:9611236-9611258 TTCCCGTCCATCACTGGCTGAGG - Intergenic
971427923 4:26534028-26534050 TTCCCCACCAACAGTAGAGCAGG + Intergenic
978431121 4:108634354-108634376 TTCCCATCTTACACTGGAGCAGG - Intergenic
981379915 4:144060605-144060627 TTCTCCTCCTTCTCTGGAACTGG + Intergenic
989563312 5:42875670-42875692 TTCCCCTCCTTCACTGGGTCTGG + Intronic
993706663 5:91179432-91179454 TTGCCCTTTATCACTGCAGCTGG - Intergenic
994497646 5:100534362-100534384 TTCTCCTCCATGACAGGAGGTGG + Intergenic
996701990 5:126459014-126459036 TTTCCCTCCATTATTGTAGCAGG + Intronic
997950986 5:138242273-138242295 CTCCCCTCCACCACGGCAGCCGG - Intergenic
998523051 5:142817766-142817788 CTCTCCACCATCACTGCAGCAGG - Intronic
1003128026 6:3371564-3371586 TTCCCCTCCACCCATAGAGCTGG - Intronic
1003374969 6:5568466-5568488 TGCCCCTCCCTCACTAGTGCGGG - Intronic
1003612976 6:7630036-7630058 TACCCCTCCCTCACTGGGGTAGG - Intergenic
1005643943 6:27823989-27824011 TTCCCCTCCCCCACCGGGGCGGG + Intergenic
1005645253 6:27831641-27831663 TTCCCCTCCCCCACCGGGGCGGG - Intergenic
1005941490 6:30563509-30563531 TTCCCCTACATCCCTGGCACTGG + Exonic
1007064417 6:38975474-38975496 TTCCCCTCCATCTTTGGACAGGG - Intronic
1007843401 6:44735016-44735038 AGCTCCTCCATCACTGGCGCTGG + Intergenic
1007927867 6:45664123-45664145 TGCCCCACCAACGCTGGAGCTGG - Intronic
1008434227 6:51456362-51456384 TCCCTGTCCACCACTGGAGCAGG + Intergenic
1010031941 6:71280329-71280351 CTTCCCTTCTTCACTGGAGCTGG - Intergenic
1010780220 6:79937107-79937129 TTCCCCTCTTTCACTGGTGAAGG - Intronic
1014459324 6:121676776-121676798 TTCCCCTCCATCACAGCAATGGG - Intergenic
1018385798 6:163301874-163301896 TTCCCCTGTTTCAGTGGAGCTGG + Intronic
1023801251 7:43837107-43837129 TTTCCCACCCACACTGGAGCAGG + Intergenic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1029403524 7:100359509-100359531 TTCTCCTCCACCACAGGAGGAGG - Exonic
1030635461 7:111943017-111943039 TTTCACTCCATCAAGGGAGCTGG + Intronic
1031356830 7:120797304-120797326 TTTCTCTCCATGACTGGAACTGG + Intronic
1032002451 7:128274263-128274285 TTCTCCTCCAGCACTGGGGATGG + Intergenic
1032081812 7:128862893-128862915 CTCCCCGCCATCCCTGCAGCCGG - Exonic
1032873459 7:136011445-136011467 TTCCCCTTCATCACTGTGGTAGG + Intergenic
1033507052 7:142014098-142014120 TTATCCTCCTTCACTGAAGCTGG - Intronic
1035039978 7:155920335-155920357 TTCTCCACCTGCACTGGAGCAGG - Intergenic
1038175595 8:25179689-25179711 TTCCCATCCATCAGAGAAGCCGG + Intergenic
1038353584 8:26805665-26805687 TTACCCACCAGCTCTGGAGCTGG - Intronic
1038605792 8:29002429-29002451 ATCCCCTCCAACACTGCATCAGG - Intronic
1040302203 8:46193916-46193938 TTCCCCTGAATCCCTGAAGCTGG - Intergenic
1040936524 8:52787649-52787671 TTCCCCTCCTTCCCTTGAACAGG - Intergenic
1042664415 8:71190414-71190436 TTCCCATCCAACACTGGAAAGGG - Intergenic
1044008751 8:86966303-86966325 TCCCACTCCAAGACTGGAGCGGG + Intronic
1046670356 8:117050229-117050251 ATCCCCTCAAACACTTGAGCAGG + Intronic
1046827920 8:118712053-118712075 TTCCCCTGCATCACCTGGGCAGG - Intergenic
1050192534 9:3043166-3043188 TCCCTCTCCATTACTGGATCTGG - Intergenic
1051014409 9:12458284-12458306 CTTCCCTCCATGACTGTAGCAGG + Intergenic
1055916920 9:81412653-81412675 TTGCTCTCCATCACTGTAGATGG - Intergenic
1055929834 9:81548731-81548753 ATCACCTCCATCATGGGAGCAGG - Intergenic
1059016990 9:110529929-110529951 TTCCCCTTAAGAACTGGAGCAGG - Intronic
1061450616 9:130665140-130665162 TTCCCCTCCTGCGCTTGAGCTGG + Intronic
1061604204 9:131696213-131696235 ATCCCCTCCCTCTCTGGATCAGG - Intronic
1061926710 9:133809479-133809501 ACCCCCTCCAGCACAGGAGCAGG + Intronic
1186481485 X:9899285-9899307 TTCCCCTTCATCACACGAGGAGG + Intronic
1189153293 X:38729619-38729641 TTCCCCTCCATCTTTGGAGGAGG + Intergenic
1192852959 X:74977256-74977278 CTCCCCTGCTCCACTGGAGCAGG - Intergenic
1193880001 X:86910337-86910359 ATCTCATCCAGCACTGGAGCAGG + Intergenic
1196141109 X:112264718-112264740 ATCCCCTCCCACACTGGAGCTGG + Intergenic
1199848997 X:151711910-151711932 TTCCCCTTCCTCTCTGGCGCAGG + Intergenic
1200123587 X:153802742-153802764 TTCCCAGCCATCAGTGGAGAGGG + Exonic
1201223290 Y:11791679-11791701 TTCTCCTCCATGGCAGGAGCAGG - Intergenic
1201509775 Y:14746260-14746282 CTTCCCTCCATCACTTCAGCTGG + Intronic
1201554522 Y:15254694-15254716 GTCTCCTCCCTTACTGGAGCTGG - Intergenic