ID: 1174373833

View in Genome Browser
Species Human (GRCh38)
Location 20:50112670-50112692
Sequence AGGGGCCTTGGGATGTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 250}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174373833_1174373851 26 Left 1174373833 20:50112670-50112692 CCTCCAGACATCCCAAGGCCCCT 0: 1
1: 0
2: 3
3: 18
4: 250
Right 1174373851 20:50112719-50112741 TGGGACTTCCATCCGCTGTGGGG 0: 1
1: 0
2: 0
3: 6
4: 102
1174373833_1174373849 24 Left 1174373833 20:50112670-50112692 CCTCCAGACATCCCAAGGCCCCT 0: 1
1: 0
2: 3
3: 18
4: 250
Right 1174373849 20:50112717-50112739 TATGGGACTTCCATCCGCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 50
1174373833_1174373842 6 Left 1174373833 20:50112670-50112692 CCTCCAGACATCCCAAGGCCCCT 0: 1
1: 0
2: 3
3: 18
4: 250
Right 1174373842 20:50112699-50112721 CGCACCCCTGGCACCCAGTATGG 0: 1
1: 0
2: 1
3: 12
4: 112
1174373833_1174373850 25 Left 1174373833 20:50112670-50112692 CCTCCAGACATCCCAAGGCCCCT 0: 1
1: 0
2: 3
3: 18
4: 250
Right 1174373850 20:50112718-50112740 ATGGGACTTCCATCCGCTGTGGG 0: 1
1: 0
2: 2
3: 4
4: 57
1174373833_1174373843 7 Left 1174373833 20:50112670-50112692 CCTCCAGACATCCCAAGGCCCCT 0: 1
1: 0
2: 3
3: 18
4: 250
Right 1174373843 20:50112700-50112722 GCACCCCTGGCACCCAGTATGGG 0: 1
1: 0
2: 1
3: 13
4: 128
1174373833_1174373837 -6 Left 1174373833 20:50112670-50112692 CCTCCAGACATCCCAAGGCCCCT 0: 1
1: 0
2: 3
3: 18
4: 250
Right 1174373837 20:50112687-50112709 GCCCCTCTCAGCCGCACCCCTGG 0: 1
1: 0
2: 1
3: 41
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174373833 Original CRISPR AGGGGCCTTGGGATGTCTGG AGG (reversed) Intronic
900033944 1:391580-391602 AGGGGCCTGGGCAGCTCTGGGGG + Intergenic
900054779 1:621470-621492 AGGGGCCTGGGCAGCTCTGGGGG + Intergenic
900363370 1:2300509-2300531 AGGGGCCTTGGTAGGGCGGGTGG + Intronic
900460334 1:2799611-2799633 AAGGGCCTTGGGAGGCCAGGAGG + Intronic
900608507 1:3534635-3534657 CGTGGCCTTGGGGTGTCTGCTGG - Intronic
900704935 1:4074633-4074655 AGGGGCCTGGGGATTTGTGTGGG - Intergenic
901153545 1:7120689-7120711 ATGGGCTTTGGGATCTGTGGTGG - Intronic
901477532 1:9500900-9500922 AGTGGCACTGGGACGTCTGGAGG + Intergenic
903004314 1:20288648-20288670 GGGAGCCTGGGGATGTGTGGAGG + Intergenic
903450804 1:23452552-23452574 ATGAGCCTGGGGAGGTCTGGAGG - Intronic
903738792 1:25546135-25546157 AGGGGCCATGGGGTATGTGGGGG + Intronic
903753838 1:25647170-25647192 TGGGGCCTGGGGAAGTCAGGTGG + Intronic
903763030 1:25712492-25712514 AGGGGCCTTGGCCTGTTGGGAGG + Intronic
904370054 1:30042623-30042645 AGGTGCCAAGGGATGTCTGCAGG - Intergenic
904548699 1:31297250-31297272 CGGAGCCTTGGGGTCTCTGGCGG + Intronic
906290998 1:44619108-44619130 AGGGCCACTGGGAAGTCTGGGGG - Intronic
907395500 1:54186849-54186871 TGGGGCCTTGGGACCTCTGGGGG + Intronic
909068496 1:70963939-70963961 AGATGCTTTGGGATATCTGGTGG - Intronic
914462577 1:147898559-147898581 AGGGGGATTGGGATTGCTGGTGG - Intergenic
915276174 1:154789745-154789767 AGTGGGCTTAGGATGTCAGGAGG - Intronic
918479543 1:184963545-184963567 AGAGGCCTTGAGATGTTTGTAGG + Intronic
922256299 1:223895744-223895766 AGGGGCCTGGGCAGCTCTGGGGG + Intergenic
923125993 1:231034965-231034987 AGGAGACTGGGGATGTCTAGCGG - Intronic
923226521 1:231943070-231943092 AGGGGCCTTGGGCTGTATCACGG - Intronic
924083581 1:240424873-240424895 AGGGGCCTAGACATTTCTGGAGG - Intronic
924337503 1:242998603-242998625 AGGGGCCTGGGCAGCTCTGGGGG + Intergenic
1065626248 10:27631857-27631879 AGGGGCCATGTGACTTCTGGGGG + Intergenic
1067051860 10:43026214-43026236 TGGGGCCTTGGGAGGCCTGATGG + Intergenic
1067233371 10:44427101-44427123 AGTGTCCTGGGGACGTCTGGTGG + Intergenic
1069723905 10:70565627-70565649 GTGGGCCTTGGGACGTCAGGTGG + Intronic
1070154551 10:73825376-73825398 AGTGGCCTTGGGGACTCTGGAGG - Intronic
1070813226 10:79308703-79308725 ATGGGGCTTGTGATTTCTGGGGG + Intronic
1070984122 10:80673539-80673561 AGGGGCTTTGGCATGCCTTGGGG - Intergenic
1071318490 10:84427597-84427619 AGGGGTGTTGGGAAGACTGGTGG + Intronic
1071718156 10:88117521-88117543 AGGTTCTTTGAGATGTCTGGGGG + Intergenic
1071721675 10:88152861-88152883 AGAGGCCTTGCCATGCCTGGAGG + Intergenic
1073441569 10:103555532-103555554 AGGGGTCTGGGGCTGTGTGGGGG + Intronic
1074105733 10:110388551-110388573 AGGGGCTGGGGGAAGTCTGGAGG - Intergenic
1074377727 10:112952545-112952567 TGGCGCCTTGGGATGTATGGCGG + Intronic
1074534702 10:114320513-114320535 AGAGGCCTGGGGATGACTTGGGG - Intronic
1074912668 10:117925617-117925639 AGAGGTCTGGGGATTTCTGGTGG - Intergenic
1075025327 10:118979749-118979771 AAGGGCCTTGGCGTGTGTGGAGG - Intergenic
1075683498 10:124348664-124348686 AGAGGGCTGGGGGTGTCTGGGGG - Intergenic
1077197435 11:1288456-1288478 AGGGGCCCTGGGTGGTTTGGTGG - Intronic
1077907003 11:6542383-6542405 GTGGGCCTTGGGATGCCTGTGGG + Intronic
1078011550 11:7576521-7576543 AGGGGCCTTGGAAAGGCTGGCGG - Intronic
1080645115 11:34182480-34182502 TGGGGCATTGGGTTCTCTGGGGG + Intronic
1083841274 11:65305722-65305744 AAGGGACTTGGGAGGACTGGGGG - Intergenic
1084488599 11:69465433-69465455 AGGGGCCTGCAGCTGTCTGGTGG + Intergenic
1084514181 11:69627118-69627140 AGGGGCCTTGGTGTTTGTGGGGG - Intergenic
1085079122 11:73619452-73619474 AGGGGCTTATGGATGTCAGGTGG + Intergenic
1085454871 11:76660122-76660144 GGGGGCCTTGGGAGGCCTGGAGG - Exonic
1085456418 11:76667971-76667993 AGGGGCTCTGGGAGGACTGGAGG - Intronic
1088794727 11:113258180-113258202 AGGTGCCCTGGGATATCTGCTGG - Intronic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1090479079 11:127051988-127052010 AAGGGGCTGGGGATGTCAGGAGG - Intergenic
1091297814 11:134486241-134486263 AGGGGCCCTGGCCTGTCTGAAGG + Intergenic
1091302137 11:134514599-134514621 AGGGGCCTTGTGTAGACTGGTGG - Intergenic
1097247547 12:57614862-57614884 AGGGCCCTCAGGAAGTCTGGGGG - Intronic
1097265501 12:57742136-57742158 AGGGGCCTTCTGAGGTTTGGGGG - Intronic
1101816960 12:108152630-108152652 AGGGGCCTTTGGAGGCCAGGTGG + Intronic
1102187145 12:110957704-110957726 AGGGACCCTGGGATGTCTCTGGG - Intergenic
1102997798 12:117362937-117362959 ATGGGCCTGGGGATGTCGTGAGG + Intronic
1103014585 12:117484156-117484178 AGGGGCTTTGAAAGGTCTGGGGG + Intronic
1103080509 12:118020166-118020188 AGGGGCCTTGGCAGGGGTGGGGG + Intronic
1104168673 12:126258542-126258564 AGGGGCCAGGGGGTGTCTGATGG - Intergenic
1106226973 13:27793178-27793200 AGGGACCCTGGGCTTTCTGGGGG + Intronic
1106364551 13:29065920-29065942 AGGGGGCTTTGCATGTCAGGTGG - Intronic
1112509667 13:99997991-99998013 AGGGGCCCTGGGCTGGGTGGGGG - Intergenic
1114183792 14:20385161-20385183 TGGGGCCTTGGCAGGTCTGGAGG - Intronic
1114846918 14:26333423-26333445 AGGGGTTTTGGAAAGTCTGGGGG - Intergenic
1115075580 14:29385748-29385770 TTGAGCCTTTGGATGTCTGGGGG - Intergenic
1117301371 14:54431726-54431748 AGTGGTCTTGGGAGGTGTGGAGG + Intronic
1117613235 14:57505285-57505307 TGGGGGGTTGGGATGTGTGGTGG + Intergenic
1117828538 14:59727488-59727510 AGGGGGCTGGGGATGGTTGGCGG + Exonic
1118983653 14:70735112-70735134 AGAGCCCTTGGTCTGTCTGGGGG + Intronic
1121010616 14:90518044-90518066 TGGGGCCATGCGCTGTCTGGAGG + Intergenic
1121731313 14:96189169-96189191 AGGGCCCTTGGGCTGCCAGGAGG + Intergenic
1122234875 14:100325849-100325871 AGGGGCCTTAGGATGGTTGGGGG - Intronic
1122838910 14:104445060-104445082 ACAAGCCTTGGGTTGTCTGGAGG + Intergenic
1123935493 15:25192075-25192097 AGGGGCTTTGGGATGCCATGGGG + Intergenic
1124626787 15:31312327-31312349 GGGGGCCTTGGGAGCTCTGCTGG - Intergenic
1127812798 15:62579065-62579087 GGGGGCCTTGGGTTGACAGGAGG + Intronic
1129217488 15:74108472-74108494 TGGGGCTTTGGGGGGTCTGGGGG - Intronic
1129387366 15:75203175-75203197 AGGGGCCTCGGGATGGCCGATGG - Intronic
1130662222 15:85839713-85839735 GGGAGCATTGGGATGACTGGAGG + Intergenic
1130997427 15:88911798-88911820 AGGGGCTTTGAGATTTCAGGAGG - Intronic
1132073001 15:98796263-98796285 AGGCGCCTGGGGGTGTGTGGGGG + Intronic
1132845605 16:1999579-1999601 AGGGGCCTTGGGAGCCCAGGGGG + Exonic
1132973420 16:2700078-2700100 AGGAGCCTTGGGAGTTCGGGTGG + Intronic
1135722498 16:24829445-24829467 CCGGGCCTTGGGAGGTTTGGGGG + Intergenic
1136043861 16:27600671-27600693 AGGGGGCCTGGGATTACTGGCGG - Intronic
1136590704 16:31216199-31216221 TGGGTCCCTGGGAAGTCTGGGGG - Intronic
1137031191 16:35526233-35526255 AGCGGCCTGGGTATGGCTGGCGG + Intergenic
1137740173 16:50762160-50762182 AGGGGGCTTGGGGTGGCGGGGGG - Intronic
1138248970 16:55487925-55487947 AGGGGCCTGGGGTTGACAGGAGG + Intronic
1138522430 16:57578554-57578576 AGACCCCTTGGGATTTCTGGTGG - Intronic
1141264121 16:82480274-82480296 GGGGGCCGTGGGATACCTGGGGG + Intergenic
1141450006 16:84092891-84092913 AGAGGCCTGGGGAAGCCTGGAGG + Intronic
1141482389 16:84315178-84315200 GTGAGCCATGGGATGTCTGGGGG - Intronic
1141768562 16:86074767-86074789 AGGGGACTTGGGAAGGGTGGTGG + Intergenic
1141972061 16:87491381-87491403 TGGGGGCTTGGGATGTACGGCGG + Intronic
1142054604 16:87985162-87985184 AGGGGGTGTGGGAAGTCTGGGGG + Intronic
1142112021 16:88338097-88338119 ATGGGCCATGGGATGTCTTGGGG - Intergenic
1142636463 17:1260447-1260469 CGGGGGCTGGGCATGTCTGGGGG + Intergenic
1144774317 17:17777358-17777380 AAGGGCCTGGGCATGTGTGGGGG + Intronic
1144831276 17:18132574-18132596 AGGGGCCTTCAGATGCCTGCTGG - Intronic
1144837484 17:18164296-18164318 AGGGGCTTTGGGATGCATGACGG - Intronic
1145888575 17:28399141-28399163 AGGGGCTTGGTGATCTCTGGAGG - Exonic
1146275883 17:31515305-31515327 AGGGGCCCTGGGAACCCTGGGGG + Intronic
1148223389 17:45881160-45881182 AGGGACCTTGAGATGACGGGTGG - Intergenic
1149554979 17:57567033-57567055 AGGGAGCTTGGGAGGTTTGGGGG + Intronic
1150435659 17:65152258-65152280 AGTGTCCTTGGTATGGCTGGGGG + Intronic
1150950570 17:69799005-69799027 AGTGGCCTATGCATGTCTGGTGG - Intergenic
1151231590 17:72688997-72689019 AGGGGCCCTGGGCAGTGTGGGGG - Intronic
1151279721 17:73064458-73064480 TGGAGCCTTGAGATGCCTGGAGG + Intronic
1151955889 17:77380047-77380069 AGGCGCCTGGGGGTGTCTAGGGG - Intronic
1152847810 17:82613380-82613402 TGTGGCCCTGGGATGTCTTGCGG - Intronic
1154981057 18:21502700-21502722 GGGGGCCTTGGGGTGTTTTGAGG - Intronic
1156031692 18:32720631-32720653 AGGGGGCTTGGGATGACATGCGG + Intronic
1156560198 18:38116201-38116223 AGGGGCCTTGGGCTCAGTGGAGG - Intergenic
1156948979 18:42869942-42869964 AGGGCCAATGGGAAGTCTGGAGG - Intronic
1158478755 18:57802950-57802972 AGGGGCTTGGGAAGGTCTGGGGG + Intronic
1160672531 19:373058-373080 AGGGGCCTAGTGATGACTGTAGG + Intronic
1160751347 19:735938-735960 AGGGGCGTTGGGCTGTCTGGGGG + Intronic
1160806629 19:994921-994943 ACGGGCCTGGGGACGTTTGGGGG + Intronic
1161225370 19:3142248-3142270 AGGAGCTGGGGGATGTCTGGGGG + Intronic
1161349333 19:3783575-3783597 GGGGGCCTGGGGGTGCCTGGGGG + Intronic
1161411544 19:4120971-4120993 AGGGACTGTGGCATGTCTGGTGG - Intronic
1162038766 19:7956793-7956815 AGGGGTCTGGAGAGGTCTGGTGG + Intergenic
1162158612 19:8696355-8696377 TGGGGCCAGGGGAGGTCTGGGGG + Intergenic
1162462252 19:10820101-10820123 AGGGGCCTGGGGATGGCTCGGGG + Intronic
1163676449 19:18657796-18657818 AGTAGCCTTGGGCAGTCTGGGGG + Intronic
1163846334 19:19640256-19640278 AGGGGGCTTGGGCTCTCCGGGGG + Intronic
1164950393 19:32331873-32331895 AGTGGCCTTGCTATGTTTGGTGG + Intergenic
1165313241 19:35040817-35040839 AGGGGCCCTGGGCTGAGTGGAGG + Intronic
1165314413 19:35045961-35045983 AGAGGCCTTGGCACATCTGGTGG - Intronic
1165809741 19:38605350-38605372 ACGGGGCTGGGGATGCCTGGTGG - Intronic
1165893410 19:39127885-39127907 AGAGGCCCTGGCATGACTGGAGG + Intronic
1166123746 19:40701397-40701419 AGGATCCGTGGGATGGCTGGAGG + Intronic
1166300222 19:41908651-41908673 AGGGGGCTTGGAATAGCTGGTGG + Intronic
1166836503 19:45670795-45670817 ATGGGCCTTGGGCTGACGGGCGG + Intronic
1167575228 19:50314694-50314716 AGGGGCCCGGGGGTGTCTGCTGG + Intronic
1168336833 19:55601851-55601873 GGAGGCATAGGGATGTCTGGTGG + Intronic
1168386064 19:55964143-55964165 AGGGGCCATGTGATGCCTGGTGG - Intronic
925030901 2:649293-649315 AGGGTGCCTGGGCTGTCTGGGGG + Intergenic
925415596 2:3668136-3668158 AGGGGTGTTGGGATGCCTGGGGG + Intronic
926089159 2:10038797-10038819 AGGGGCCCTGGGGTGTTGGGAGG + Intergenic
927711738 2:25330510-25330532 ATGGCCCTTGGGCTGTATGGTGG - Intronic
928205917 2:29283315-29283337 AAGCTCCTTGGGATGACTGGGGG + Intronic
929044969 2:37780267-37780289 AGGGGTCTTGTGAGATCTGGTGG + Intergenic
930105536 2:47636200-47636222 AGGGGGTCTGGGATGCCTGGGGG + Intergenic
931156306 2:59634733-59634755 AGGGGCCTGGGGAAGCCTCGTGG - Intergenic
932550663 2:72766152-72766174 AGGCTCTTTGGAATGTCTGGAGG + Intronic
934090923 2:88549894-88549916 AAGGGCCTTGGGATGGAGGGTGG - Intergenic
936088204 2:109484000-109484022 AGGAGGCTGGGGTTGTCTGGTGG - Intronic
936240159 2:110781090-110781112 AGGGGCATGGGGATGCCTGCTGG + Intronic
936257524 2:110929773-110929795 AGGGGCCATGGTATAGCTGGAGG + Intronic
941870024 2:170374255-170374277 AGTGGCCTTGGGATCTTTGTGGG + Intronic
944883535 2:204039958-204039980 ATGGTCTTTGGGATGTCAGGAGG + Intergenic
947621550 2:231594178-231594200 AGGGTCCCAGGGATCTCTGGAGG - Exonic
947638597 2:231693472-231693494 TGAGGCCTTGGGATGACTGAGGG + Intergenic
948886618 2:240888122-240888144 CGGGGACATGTGATGTCTGGGGG - Intronic
1169475449 20:5927003-5927025 AGGGGGCTTGGGGTTCCTGGGGG + Intergenic
1171206926 20:23288611-23288633 AGGGGCACTGGGAGGTCTGGGGG - Intergenic
1171484552 20:25477532-25477554 CTGGGCCTTGGGACCTCTGGTGG + Intronic
1172836901 20:37878925-37878947 AGGGGATTTGGGATGTATTGAGG + Intergenic
1173521801 20:43705415-43705437 ATGGGCCTTGGGACCACTGGTGG + Intronic
1174059382 20:47821759-47821781 AGGGTCCTTGGGGGATCTGGAGG + Intergenic
1174373833 20:50112670-50112692 AGGGGCCTTGGGATGTCTGGAGG - Intronic
1174881491 20:54284001-54284023 GGAAGCTTTGGGATGTCTGGGGG + Intergenic
1175783734 20:61699330-61699352 GGGGGGCTTGTGATGACTGGGGG - Intronic
1176089063 20:63311026-63311048 AGGTGGCTTGGGGTGGCTGGGGG - Intronic
1178485268 21:33015477-33015499 GGGGACTTTTGGATGTCTGGAGG - Intergenic
1179030717 21:37717470-37717492 AGGTGGGTTGGGATGTGTGGAGG + Intronic
1179170423 21:38968815-38968837 AGAGGCACTGGGTTGTCTGGGGG + Intergenic
1179495633 21:41769649-41769671 AGGGACCTTGGGCTGCCTGCTGG - Intergenic
1179516855 21:41914506-41914528 GGGGGCCTTGGATTCTCTGGTGG - Intronic
1179633849 21:42694990-42695012 AGGGGCCTTTGGATTTGGGGCGG - Intronic
1180184512 21:46132767-46132789 AGGAGCCTTGGGATGGCTGCAGG - Exonic
1182044015 22:27260268-27260290 AGGGCCCTTGGGCATTCTGGAGG - Intergenic
1183360783 22:37382193-37382215 AGGAGCCTTGGAAAGTCTGCTGG - Intronic
1185040370 22:48500965-48500987 AGGGGCCTTGGGCAGTCAGCGGG - Intronic
1185137360 22:49080393-49080415 AGGGGCTGTGGGATGTGAGGAGG - Intergenic
1185225013 22:49647338-49647360 AGGAGCCTTGGGATGTGAGCTGG + Intronic
949206008 3:1439778-1439800 AGGAGCATTGGGATCACTGGGGG + Intergenic
950021911 3:9793215-9793237 CGGGGCCGAGGGATGTCCGGGGG + Intronic
950702776 3:14761644-14761666 ATGGGCCTGGGGAGGTATGGAGG + Intronic
950881035 3:16322800-16322822 AGGGCCCTGGGGATCTCTTGAGG + Intronic
951532618 3:23711947-23711969 AGAGGCCTGGGGATGTCTCATGG - Intergenic
952932814 3:38373249-38373271 AGGGGCCCTTGGATCTCTGAAGG + Intronic
953989785 3:47475537-47475559 AGGGGCCCGCGGAGGTCTGGTGG + Intronic
954380209 3:50215296-50215318 AGGGGCTCTGGGAGGCCTGGGGG - Intronic
955386893 3:58487522-58487544 TGGGGACTTGGGAGGTTTGGGGG + Intergenic
957743011 3:84299043-84299065 AGGTGCTTTGGGTTGTTTGGGGG - Intergenic
958983712 3:100755559-100755581 AGGGACCTAGGGTTGTTTGGGGG - Intronic
958999396 3:100944866-100944888 AGTGGCCATGAGATGTCAGGAGG + Intronic
961375346 3:126461822-126461844 AGGAGCATTAGGCTGTCTGGTGG - Exonic
961594713 3:128007054-128007076 ACTGGTATTGGGATGTCTGGGGG - Intergenic
967578355 3:191123981-191124003 AGGTGACTTTGTATGTCTGGGGG + Intergenic
967813904 3:193783042-193783064 AGGGGCTCTGGGAAGTCTGCAGG + Intergenic
968649839 4:1756153-1756175 TGGGGCCTTCGGAAGTCTGCTGG + Intergenic
969336879 4:6516244-6516266 AGGGTTCTGGGGATGTGTGGAGG - Intronic
972314618 4:37914582-37914604 AGATGTCTTTGGATGTCTGGTGG - Intronic
975589828 4:75988831-75988853 TAGAGCCTTGGGATTTCTGGTGG - Intronic
977441260 4:97070663-97070685 AGGGGCCTGAGAATGTGTGGTGG + Intergenic
979239626 4:118436700-118436722 AGGGGCCTGGGCAGCTCTGGGGG - Intergenic
981552066 4:145952049-145952071 AAGGACCTTGAGAGGTCTGGGGG + Intergenic
985538923 5:478872-478894 GGGGGCCTGGGGCTGTCAGGAGG - Intronic
987077928 5:14401799-14401821 AGCGGCTTTGGGATGTTTGGGGG + Intronic
987361767 5:17113596-17113618 AGAGCCCTGGGGATGTCTGGTGG - Intronic
987788513 5:22533700-22533722 AGAGCCCTTGGGATGTCCTGTGG - Intronic
991488686 5:67163829-67163851 CGGGTCCATGGGATTTCTGGTGG - Exonic
992070564 5:73144862-73144884 ATGGTCTTTGGGATGTCTGTGGG - Intergenic
998351636 5:141505670-141505692 GGGGGTCCTGGGATGCCTGGAGG + Intronic
998416701 5:141951453-141951475 AGGGGCCTTGAGATGCCTGTGGG + Intronic
1002441290 5:179265740-179265762 CGGGCCCTTGGGATGGCTGTTGG - Intronic
1002739876 5:181427288-181427310 AGGGGCCTGGGCAGCTCTGGGGG - Intergenic
1005808890 6:29501385-29501407 GGTCGCCTTGGGATGACTGGGGG + Intergenic
1006115786 6:31775553-31775575 AGGGGACTTGGGGTGTCTGGTGG - Intronic
1006627139 6:35405428-35405450 AGGGCCCTTGTGTTGTCTGGGGG + Intronic
1006835623 6:36997307-36997329 AGAGGACTGGGAATGTCTGGGGG + Intergenic
1013087482 6:106868701-106868723 AGTGGCCTTGGTATTCCTGGAGG - Intergenic
1013473290 6:110485332-110485354 TGTGGCTTTGGGATGTGTGGTGG - Intergenic
1014065256 6:117117299-117117321 AGGCACCTTGGCATCTCTGGGGG - Intergenic
1018169453 6:161132951-161132973 AGGGGCCCTAGGCTGTATGGAGG - Exonic
1019174767 6:170154399-170154421 AGGGGCCCTGGGTTCTGTGGAGG - Intergenic
1019174803 6:170154500-170154522 AGGGGCCCTGGGTTCTGTGGAGG - Intergenic
1019174811 6:170154520-170154542 AGGGGCCCTGGGTTCTGTGGAGG - Intergenic
1019174819 6:170154540-170154562 AGGGGCCCTGGGTTCTGTGGAGG - Intergenic
1019174849 6:170154621-170154643 AGGGGCCCTGGGTTCTATGGAGG - Intergenic
1019174872 6:170154682-170154704 AGGGGCCCTGGGTTCTATGGAGG - Intergenic
1019174892 6:170154742-170154764 AGGGGCCCTGGGTTCTGTGGAGG - Intergenic
1019174942 6:170154883-170154905 AGGGGCCCTGGGTTCTATGGAGG - Intergenic
1019244990 6:170702874-170702896 AGGGGCCTGGGCAGCTCTGGGGG - Intergenic
1020128330 7:5545575-5545597 AGGGGCCTTGGGATCTGGGAGGG - Intronic
1023741736 7:43287299-43287321 AGAGGCCCAGAGATGTCTGGGGG + Intronic
1025111573 7:56221340-56221362 AGAGGTCTTGAGATGTCTGTTGG - Intergenic
1025235518 7:57232224-57232246 AGGGTCCTTGGGGGATCTGGAGG - Intergenic
1026674016 7:72414443-72414465 AGGGGTCCTGGGATGGGTGGTGG + Intronic
1030546362 7:110900959-110900981 AGGGCCCTTGGTATGTCTGGAGG - Intronic
1032515994 7:132506724-132506746 AGGGGTCTTCGCATGGCTGGTGG - Intronic
1034553083 7:151833453-151833475 AGGGCCCTGGGGAAGTCTGCAGG + Intronic
1035082552 7:156229290-156229312 TGGGGCCTTGGGAGGTGAGGAGG - Intergenic
1035503133 8:105313-105335 AGGGGCCTGGGCAGCTCTGGGGG + Intergenic
1038503667 8:28065671-28065693 AGGGGATTTGGGATGTATGGTGG + Intronic
1044747533 8:95385304-95385326 GGGAGCCTTGGGTTCTCTGGTGG - Intergenic
1046794042 8:118351261-118351283 AGGGGAAATGGGATGTCTGCAGG + Intronic
1048857572 8:138697588-138697610 AGGCTCCTGGGGATGGCTGGTGG - Intronic
1049280605 8:141742173-141742195 AGGGCCCTGGGGATCTCTAGTGG + Intergenic
1050584362 9:7094922-7094944 AGGGGCCTTGGGATAGCTTCTGG + Intergenic
1053042997 9:34890593-34890615 GGGGCCCATGGGATGCCTGGTGG + Intergenic
1053286244 9:36851210-36851232 AGGGGACTGGGGATGTTGGGTGG + Intronic
1057395518 9:94676452-94676474 AGGGGCCTTTGGCTATCTGGGGG + Intergenic
1057942771 9:99299272-99299294 AGGGCCCTTTGGAGGTCTGTGGG - Intergenic
1060938089 9:127527451-127527473 AGAGGCCTTGGGAGGACTTGGGG - Intronic
1061618672 9:131796660-131796682 TGGGCCCTTGGGAAGACTGGTGG + Intergenic
1061877898 9:133554133-133554155 CGGGGGCTGGGGATGTGTGGTGG - Intronic
1062062224 9:134502687-134502709 AGGGGCCTTGGGGTGAGAGGTGG + Intergenic
1062292824 9:135804934-135804956 AGGAGGCTTGGGAGGGCTGGGGG - Intergenic
1062337492 9:136078661-136078683 AGGGGCGTGGGAATGGCTGGGGG + Intronic
1062433249 9:136535246-136535268 AGGGGCCTTGTGAACCCTGGGGG - Intronic
1062445067 9:136590170-136590192 AGGGGGCTCGGGATGGCTGAAGG + Intergenic
1203605183 Un_KI270748v1:52095-52117 AGGGGCCTGGGCAGCTCTGGGGG - Intergenic
1186459900 X:9739839-9739861 AGGGACCATGGGTTGGCTGGTGG + Intronic
1187305334 X:18090327-18090349 AGGGGTCTTGGGATTTCTCCAGG - Intergenic
1190407310 X:50100924-50100946 AGGGGCCTTGGGAGCTCAAGGGG - Intergenic
1196816337 X:119667836-119667858 AGGAGCCCTGGGAGGGCTGGGGG - Intronic
1198012338 X:132570714-132570736 AGGGTCTTGGGGATGTCTAGGGG + Intergenic
1201236732 Y:11919119-11919141 AGGGGCTTTGGGAGGTGTTGAGG - Intergenic
1202387368 Y:24338496-24338518 AGGGGCCTGGGCAGCTCTGGGGG - Intergenic
1202483418 Y:25331632-25331654 AGGGGCCTGGGCAGCTCTGGGGG + Intergenic