ID: 1174374002

View in Genome Browser
Species Human (GRCh38)
Location 20:50113186-50113208
Sequence GCGCGCCTGCGCATCAGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174374002_1174374005 14 Left 1174374002 20:50113186-50113208 CCGGCCCTGATGCGCAGGCGCGC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1174374005 20:50113223-50113245 GCCGCCGCTGACGCCCGCCCCGG 0: 1
1: 2
2: 2
3: 76
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174374002 Original CRISPR GCGCGCCTGCGCATCAGGGC CGG (reversed) Intronic
900428774 1:2592405-2592427 GGGCGCCAGTGCATCAGGGGAGG - Intronic
900671447 1:3857255-3857277 CCGCGCCTGCGCACAAGGGGAGG + Intronic
900998172 1:6134053-6134075 GCGCCCCCAAGCATCAGGGCAGG + Intronic
904199875 1:28812622-28812644 GCGGGCCGGCGCCGCAGGGCTGG + Intronic
908501106 1:64744895-64744917 GCGCGCCTGTGCGCCGGGGCCGG + Intergenic
911219712 1:95234109-95234131 CCGCGCCTCCGCAACCGGGCGGG - Intronic
916490500 1:165298176-165298198 GCCCGCCAGCGCCTCAGTGCAGG + Intronic
917141633 1:171841457-171841479 GCGCGCCTGCGCGGGCGGGCAGG - Intergenic
919872006 1:201829106-201829128 CCGCGCCTGCGCACCAGAGGCGG - Intergenic
920556659 1:206909427-206909449 CCGCGGCTGCCAATCAGGGCAGG + Intronic
923036255 1:230287123-230287145 GCCCGCCGGCTCATGAGGGCTGG + Intergenic
924624661 1:245688457-245688479 GCGCGCCTCCGCCTCGGGCCCGG - Exonic
1063347670 10:5326606-5326628 AGGCAGCTGCGCATCAGGGCAGG - Intergenic
1065872840 10:29970758-29970780 GCCCGCATGGGCATCAGGCCAGG + Intergenic
1077173463 11:1178565-1178587 GGGCGCCAGGGCATCTGGGCAGG - Intronic
1077305931 11:1868705-1868727 GCTCGCCTGGGCTTCTGGGCAGG - Intronic
1081525079 11:43922395-43922417 GGGAGCCTGAGCCTCAGGGCTGG + Intergenic
1083389456 11:62337421-62337443 CTGCGCCTGCGCACGAGGGCGGG - Intergenic
1084539105 11:69775466-69775488 GGCCGCCTGCCAATCAGGGCCGG + Intergenic
1089456839 11:118630710-118630732 GTGTGCCTGTGCATCAGTGCTGG + Intronic
1096042248 12:48528094-48528116 GGGCTCCTGCGTATCAGGGCAGG - Exonic
1102786082 12:115606186-115606208 GCGCGCCTGCCTCTGAGGGCCGG + Intergenic
1106602566 13:31200254-31200276 GCGCGCCGGCGGGGCAGGGCTGG - Intronic
1113861570 13:113490699-113490721 CCGCGCCTGCGCAGAAGGCCGGG - Exonic
1122044819 14:99016003-99016025 GCGGGCCTGCTCACCATGGCTGG - Intergenic
1128124970 15:65185421-65185443 GCGCGCCTGCGCCCTAGGCCCGG + Intergenic
1135479853 16:22813801-22813823 GTGGGACCGCGCATCAGGGCAGG + Intergenic
1136505222 16:30698694-30698716 GCACGCGTGCGCAGAAGGGCGGG - Intronic
1142345906 16:89553881-89553903 GCCCTCCTGCGCCTCAGGGAAGG - Exonic
1142354221 16:89594515-89594537 GCTCGCCTGAGCAGCAGAGCGGG - Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143392944 17:6570937-6570959 GGCCGCCTGGGCATGAGGGCGGG - Intergenic
1145197641 17:20908662-20908684 GCGCGCCTGCGCGTGGGGGGGGG - Intergenic
1145992894 17:29089879-29089901 CCGCGCATGCTCAGCAGGGCTGG - Intronic
1147879763 17:43646112-43646134 GCGCGCCCGGGGAGCAGGGCAGG + Intronic
1151933404 17:77247211-77247233 GCGCGTCTGCGCACCGGGCCGGG + Intergenic
1156447628 18:37249090-37249112 GCCTGCCTGCCCACCAGGGCTGG + Intronic
1159100111 18:63949236-63949258 GGGCGCCTGGGCAGGAGGGCGGG - Intergenic
1161063801 19:2227938-2227960 CCCCGCCTGCGCACCTGGGCCGG + Intronic
1162374193 19:10295441-10295463 GCGCGCCAGCTGATCTGGGCTGG - Exonic
1163489001 19:17606048-17606070 CCGCGCCTGCGCCTTAGCGCGGG - Exonic
1163743919 19:19033608-19033630 GCGCGCTTGCGCAAGAGAGCCGG - Exonic
1165795958 19:38519282-38519304 GGGCGGCTGCGCAAGAGGGCAGG + Exonic
1165831092 19:38730816-38730838 GCGCACCTGCTGCTCAGGGCAGG - Exonic
1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG + Intronic
934774094 2:96926381-96926403 CCAGGCCTGCGCATCAGAGCAGG + Intronic
936585827 2:113756699-113756721 GCGCGCCACCGCTTCCGGGCTGG - Exonic
947519891 2:230837456-230837478 GCGCTCCTGTGCCTCAGGGTTGG - Intergenic
948231411 2:236351893-236351915 GAGCCCCTGGGCAGCAGGGCAGG + Intronic
1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG + Intergenic
1174374002 20:50113186-50113208 GCGCGCCTGCGCATCAGGGCCGG - Intronic
1175421946 20:58840270-58840292 GCGCGGCTGCCCAACAGCGCCGG + Intronic
1176015545 20:62929359-62929381 GCGCGCCTGGGCCTCGGCGCTGG + Intronic
1176238017 20:64063257-64063279 GCCCGCCTCCGCAGCCGGGCAGG - Exonic
1183737984 22:39654406-39654428 GGGCGCATGGGCAGCAGGGCAGG + Intronic
1184720300 22:46308753-46308775 GCGGGCCTGGGCACCAGAGCTGG - Exonic
1185032694 22:48453016-48453038 GAGGGCCTGTGCATCGGGGCGGG + Intergenic
949969981 3:9396676-9396698 GCGCCCCTGCGCAACGTGGCAGG - Intergenic
954132405 3:48567357-48567379 GGGGGCATGTGCATCAGGGCAGG - Intronic
961281100 3:125766471-125766493 GCGGAGCTGGGCATCAGGGCGGG - Intergenic
968051496 3:195658031-195658053 CTGCGCCTGCGCACCACGGCCGG - Intergenic
968104322 3:195990302-195990324 CTGCGCCTGCGCACCACGGCCGG + Intergenic
968302618 3:197627892-197627914 CTGCGCCTGCGCACCACGGCCGG + Intergenic
968506518 4:973573-973595 CCGCGCCTGCGCAGTGGGGCAGG - Intronic
968620665 4:1602071-1602093 GCGTGCCAGGGCACCAGGGCTGG + Intergenic
969051683 4:4377780-4377802 CAGGGCCTGTGCATCAGGGCTGG + Intronic
969214955 4:5713980-5714002 GGGCACCTGTGCATCAGGGTAGG - Intronic
969912844 4:10461270-10461292 GTGGGCCTGCGCCGCAGGGCGGG - Intergenic
970593188 4:17577179-17577201 GTGCGCCCGCGCATGCGGGCGGG - Exonic
981334962 4:143559542-143559564 GCGCGCTGGCGCTGCAGGGCGGG + Intergenic
984249122 4:177310280-177310302 GCGCGCCTGCGCAGGAGAGGAGG + Intronic
1002277442 5:178113392-178113414 GCGCCTCTGCGGGTCAGGGCCGG + Intergenic
1006457145 6:34138381-34138403 GCGCTCCTGAGCACCTGGGCTGG - Intronic
1009437727 6:63636476-63636498 GCGCGCCCGCGCCTCAGCGGCGG - Intronic
1015793781 6:136990066-136990088 GCGCGTCTGCGGATCAGCGCAGG - Intergenic
1025231047 7:57203524-57203546 GCGCGCTGGCGCTGCAGGGCAGG - Intergenic
1026867182 7:73831045-73831067 GCTGGCTTGCGCATCAGGACTGG + Exonic
1034274671 7:149818791-149818813 GCACACCTGTGCATGAGGGCAGG - Intergenic
1034840220 7:154388616-154388638 GCTGGCCTGGGCATCAGGGCAGG - Intronic
1051079618 9:13279359-13279381 GCGCGCCTCGGCCTCTGGGCCGG + Intronic
1056643316 9:88388725-88388747 GCGGGCCTGGGCCTCGGGGCGGG + Intronic
1197215223 X:123860414-123860436 CCGCGCCAGCCCATCAGGGGTGG + Intronic